Presentation is loading. Please wait.

Presentation is loading. Please wait.

Semikvatitativ Actinnormaliseret PCR Lane1-2: Tarm, Lane 3-4 Neuralkirtel, Lane 5-6: Ovarie, Lane 7-8. Gællesæk. A:20 cykler b:25 cykler c:30 cykler.

Similar presentations


Presentation on theme: "Semikvatitativ Actinnormaliseret PCR Lane1-2: Tarm, Lane 3-4 Neuralkirtel, Lane 5-6: Ovarie, Lane 7-8. Gællesæk. A:20 cykler b:25 cykler c:30 cykler."— Presentation transcript:

1

2

3 Semikvatitativ Actinnormaliseret PCR Lane1-2: Tarm, Lane 3-4 Neuralkirtel, Lane 5-6: Ovarie, Lane 7-8. Gællesæk. A:20 cykler b:25 cykler c:30 cykler d:35 cykler

4

5 PCR-check af positive kloner

6 -51 GCTCGGTACCWAGCTCGCCCTTAGCGGCCGCGGAATTTATAAGTTCTGAAA +1 L G M F S F K V C V V F I I S L H A T V L A G D N T Y L T C S E X A P P L ATGTTTTCGTTCAAAGTGTGCGTCGTGTTCATCATCAGTCTTCATGCRACTGTGTTGGCTGGAGACAACACCTACTTAACTTGTTCCGAARGTGCGCCG CCATTG105 A G G Y ——————————> <————————— ——— Neck —————————————— K A D R G P P G P A G P T G P K G P K G D T G A T T E L E N T V H D L70 AAAGCGGACCGAGGRCCACCTGGGCCAGCGGGGCCGACCGGTCCCAAAGGGCCAAAAGGAGACACTGGAGCCACTACTGAGCTAGAGAACACCGT GCATGATTTG210 Y Y ————————————————————————————————————————————— Neck ——————————————————— —————————————————————————————— R E E R L E K A E R D I V L M T K T I N E I N S H T C Q C M E V I D G K105 GAAGAAAGGTTGGAAAAGGCCGAGAGGGATATTGTGTTGATGACAAAAACGATTAACGAAATTAACAGTCACACTTGCCAATGTATGGAAGTCATTGAT GGGAAA315 C C ——————————— Neck ————————————> <——————————————————————————— CRD —————————— —————————————————————————— I D R V W Y G P G N G Y L Y L V I V S D M T Y D E A K S K C S K Y G A T L A140 GTTTGGTACGGACCCGGGAACGGTTATCTATACCTGGTTATTGTAAGCGATATGACGTACGATGAAGCTAAATCGAAATGTAGCAAATACGGAGCTAC CCTTGCA420 A TA C G —————————————————————————————————————————————— CRD —————————————————— —————————————————————————————————— V H G P K N R D I M K I L H K Q L P V I T Q E D Y W I G L T D K Q G E175 GTGCACGGACCCAAGAACAGAGATATTATGAAAATCCTTCACAAACAGTTACCGGTAATCACCCAGGAAGACTATTGGATTGGTCTTACCGATAAACA GGGCGAA525 —————————————————————————————————————————————— CRD —————————————————— —————————————————————————————————— A Y E N A G R Y V W E D G S S L K S S E A N W N P G Q P D D Y G N A E D C V G G210 GGCAGATATGTGTGGGAGGATGGCTCCTCACTGAAAAGCAGCGAAGCGAATTGGAATCCTGGTCAACCGGACGACTATGGAAATGCAGAAGATTGTG TCGGTGGC630 C T G A C T G A GCC —————————————————————————————————————————————— CRD —————————————————— —————> Y Q N Y L D S L Q W N D W K C S D G R L Y A L C E R R E.245 AATTACCTAGACAGTCTTCAATGGAATGACTGGAAGTGCTCAGACGGACGGTTATACGCGCTTTGCGAACGTCGAGAGTAGACCTTGGCTTAATACCA AACAAAT712 AC A A

7

8

9 Fylogeni baseret på MBL aminosyre primærstruktur

10

11

12


Download ppt "Semikvatitativ Actinnormaliseret PCR Lane1-2: Tarm, Lane 3-4 Neuralkirtel, Lane 5-6: Ovarie, Lane 7-8. Gællesæk. A:20 cykler b:25 cykler c:30 cykler."

Similar presentations


Ads by Google