Presentation is loading. Please wait.

Presentation is loading. Please wait.

Www.company.com GB2.0 GOLDENBRAID 2.0: A comprehensive DNA assembly framework for Plant Synthetic Biology and Molecular Farming Plant Genomics and Biotechnology.

Similar presentations


Presentation on theme: "Www.company.com GB2.0 GOLDENBRAID 2.0: A comprehensive DNA assembly framework for Plant Synthetic Biology and Molecular Farming Plant Genomics and Biotechnology."— Presentation transcript:

1 GB2.0 GOLDENBRAID 2.0: A comprehensive DNA assembly framework for Plant Synthetic Biology and Molecular Farming Plant Genomics and Biotechnology Group IBMCP (CSIC-UPV), Valencia

2 GB2.0 Plant Synthetic Biology Multigenic traits Plant Genetic Engineering Single gene traits MOLECULAR FARMING The transit from Biotechnology to Synthetic Biology

3 GB2.0 The benefits of Modular Design

4 GB2.0 Grammar Database Functionally-tested genetic modules The GoldenBraid 2.0 Framework Software tools Interchangeability

5 GB2.0 Type IIS enzymeType II enzyme nnnn cctgag ctcgag Type IIS restriction enzymes GoldenGate: Engler, C., R. Gruetzner, R. Kandzia, and S. Marillonnet, PLoS One, (5): p. e5553. Engler, C., R. Kandzia, and S. Marillonnet, PLoS One, (11): p. e3647. GoldenBraid 1.0: Sarrion-Perdigones, A., E.E. Falconi, S.I. Zandalinas, P. Juarez, A. Fernandez-Del-Carmen, A. Granell, and D. Orzaez,. PLoS One, (7): p. e21622 Type IIS enzyme Type II enzyme The chemistry behind GoldenBraid

6 GB2.0 The chemistry behind GoldenBraid Suffix AATG Prefix GCTT PROMOTER + UTR +ATG CDSTERMINATOR GGAGAATG GCTTCGCT

7 GB2.0 d t u n e s r a n d GB 2.0: analogy with the grammar

8 GB2.0 understand do not it you ! GB 2.0: analogy with the grammar

9 GB2.0 you do not understand it! If you can’t compute it GB 2.0: analogy with the grammar

10 GB2.0 GBparts Transcriptional Units Genetic Modules Multipartite Binary, Iterative, GB works as a double iterative loop that allows the stepwise assembly of new TUs indefinitely. GB supports multipartite assemblies of several (up to 8) small DNAparts in a single reaction to create a transcriptional units The GB 2.0 assembly strategy Basic Genetic elements

11 GB2.0 pDGB α2pDGB Ω2 pDGB α1 pDGB Ω1 α LEVEL (BsaI reactions) Ω LEVEL (BsmBI reactions) The 4 pDGBs give a double-loop structure (braid)

12 GB2.0 GB database GB TU2 SEQUENCE GB part GB TU1 GB Module GB Domesticator GB TU Assembler GB Binary Assembler GB part GB 2.0 software tools

13 GB2.0 35S Jchain TNos 35S SP TNos 35S SC TNos CLVL 35S SP TNos CHVH SP GoldenBraid 2.0: building a secretory IgA

14 GB2.0 The GB2.0 workflow 35S SC TNos SP TNos35SSPhSC DOMESTICATION AGCC GCTT AATG CGCT GGAG AATG GCTT AGCC MULTIPARTITE ASSEMBLY 35S SC TNos SP PARTS and SUPERPARTS TRANSCRIPTIONAL UNIT BINARY ASSEMBLY 35S Jchain TNos 35S SC TNos SP GENETIC MODULE

15 GB2.0 SUBJECT PREDICATE STOP VERB ART NOUN - English sentence The Grammar ADJ Biotechnology has a huge potential. TTCGAGCCGCAGGGAGTCCCTACTCCATAATGGCTTGGTACGCT ’ NT TRANSCRIBED REGION 3’ NT 5´UTRLINK3´UTR (PROM+UTR+ATG) 13 (SP) (CDS)17-21 (TER) TL1TL2TL4TL3 17 TGAC 03 35S SC TNos SP - Transcriptional Unit ART

16 GB2.0 SC AGCC GCTT Domestication of the Secretory Component

17 GB2.0 35S SC TNos SP Multipartite Assembly of the TU encoding the SC GB DB DOMESTICATED

18 GB2.0 pDGB_Ω2 TU SC TU JC Binary Assembly of the TUs encoding the SC and the JC

19 GB2.0 pDGB_α1 TU HC TU LC TU JC TU SC Binary Assembly of the preassembled genetic modules

20 GB2.0 Secretory IgA construction 4 TUs: 13kb

21 GB2.0 The major benefit of GB2.0 framework: interchangeability Every story has an end, but with GB every ending is just a new beginning.

22 GB2.0 GB2.0 is a convenient framework for Plant Synthetic Biology, including Molecular Farming and Metabolic Engineering To learn more: Conclusions Hands-on course on multiple gene assembly technologies for metabolic engineering and fruit biotechnology Valencia (Spain), September 9th to 13th, 2013 Organized by COST Actions FA1006 (PlantEngine) and FA1106 (QualityFruit)

23 THANK YOU! IBMCP Alejandro Sarrión Javier Forment Paloma Juárez Estefanía Huet Asun Fernández Jose Manuel Julve Diego Orzáez Fruit genomics and Biotechnology Group. COMAV Peio Ziarsolo Jose Blanca


Download ppt "Www.company.com GB2.0 GOLDENBRAID 2.0: A comprehensive DNA assembly framework for Plant Synthetic Biology and Molecular Farming Plant Genomics and Biotechnology."

Similar presentations


Ads by Google