Presentation is loading. Please wait.

Presentation is loading. Please wait.

Viral Evolution and Recombination Peter Norberg

Similar presentations


Presentation on theme: "Viral Evolution and Recombination Peter Norberg"— Presentation transcript:

1 Viral Evolution and Recombination Peter Norberg

2 Phylogenetic analysis Reconstruction of evolutionary history Relationship Distance Common ancestors

3 Tree of Life

4 Viruses and Viral Evolution Viruses are not living organisms! but evolving… Genetic material (DNA or RNA) Need to adapt to their environment!

5 Different representations of phylogenetic trees A B CD A B C D A B C D A B C D A B C D

6 Bootstrap -A way to get “statistical significance” of a certain topology -Construct several new sequence sets (1000 st.) -A new sequence set is generated by randomly picking of columns from the original set -Apply the phylogenetic algorithm on all sets. -Make one consensus tree from all trees

7 Bootstrapping A: AACTTAACCACGCTATCGATGCAATTATATA B: AATTTGACTGCGGTACCGATCCAATTATATA C: AATTTGACTGGGCTACCGATCCAATTATATA D: AACTTAACCGCGCTACTGATCGAATTATATA A: CACC B: TGCT C: TGCT D: CAGC ADBCADBC 96 ABCDABCD 3 3 ACBDACBD 1 1

8 Recombination A powerful genetic mechanism Used by all animals (extremely few exceptions) Beneficial despite “the cost of sex” Speeds up evolution (up to 10,000 times) Accumulate beneficial mutations Expel deleterious mutations Bacteria through HGT Viruses!

9 Recombination

10 Recombination and phylogeny X A B C D E F G H I A B C D E F G H I H

11 X A B C D E F G H I H

12 Phylogenetic networks X A B C D E F G H I H

13 Methods for detection of recombinants -Detecting conflicting phylogenetic signals Phylogenetic networks (SplitsTree) Can be due to recombination or homoplasy

14 Phylogenetic network

15 Methods for detection of recombinants -Analyze conflicting phylogenetic signals, recombination vs homoplasy, and define breakpoints Bootscan (SimPlot) Similarity plots (SimPlot) Statistical tests (phi-test) RDP, Geneconv, MaxChi, Chimaera, SisScan, 3Sec, LARD, Topal, …. (RDP)

16 Bootscan


Download ppt "Viral Evolution and Recombination Peter Norberg"

Similar presentations


Ads by Google