Presentation is loading. Please wait.

Presentation is loading. Please wait.

제5장 동물 분자육종을 위한 DNA 표지인자의 이용

Similar presentations


Presentation on theme: "제5장 동물 분자육종을 위한 DNA 표지인자의 이용"— Presentation transcript:

1 제5장 동물 분자육종을 위한 DNA 표지인자의 이용
동물육종 방법의 변화 전통적인 통계적 보정 방법에 의한 동물육종 DNA상의 특성 및 유전자 조작에 의한 동물육종 (교재 133 참조)

2 Molecular Methods for Identification of Genotypes Basic Concept
DNA의 다형현상 The number of nucleic acid or amino acid differences between two organisms is proportional to the time since they diverged from a common ancestor. 1 AAGGCTA 2 AAGGGTA 3 AAGGGTG Example Rate of Evolution = 1bp per 100 years MOLECULAR DIFFERENCES 100years 200 years TIME

3 P = E+G MARKERS IN BIOLOGY Phenotypic markers = Naked eye markers
Flower colors, shape of pods, etc.. P = E+G

4 Polymorphisms Differences can be detected:
Visually – morphological traits B. Vandenberg P1 F1 P2

5 Molecular markers Sequencing (SNPs) Microsatellites (SSRs)
Multi-locus fingerprints AFLP (Amplified Fragment Length Polymorphism) Resolution power RAPD (medium) (random amplified polymorphic DNA) RFLP, Restriction Fragment Length Polymorphisms (high) SSCP, Single Strand Conformation Polymorphisms (very low)

6 DNA의 다형현상 (DNA Polymorphism=differences)
제한효소 절편다형 (Restriction Fragment Length Polymorphisms, RFLP) 단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) 임의증폭다형(Random Amplified Polymorphic DNAs, RAPD) 초위성체에 의한 다형관찰법 (Simple Sequence Length Polymorphism, SSLP)

7 Molecular differences can be caused by:
왜 DNA의 다형현상은 일어나는가? Molecular differences can be caused by: INSERTIONS Johnny is a boy Johnny is a bad boy DELETIONS The cow jumped over the moon The cow over the moon MUTATIONS Bean Been These may cause phenotypic differences

8 DNA의 다형현상 E. coli isolate A E. coli isolate B
T-T-G-A-C-T-A-A-C-C-A-G-A-T-C I I I I I I I I I I I I I I I A-A-C-T-G-A-T-T-G-G-T-C-T-A-G E. coli isolate A E. coli isolate B SNP(single nucleotide polymorphism) T-T-G-A-C-T-A-C-C-C-A-G-A-T-C I I I I I I I I I I I I I I I A-A-C-T-G-A-T-G-G-G-T-C-T-A-G

9

10 Restriction Fragment Length Polymorphism
제한효소 절편다형 (Restriction Fragment Length Polymorphisms, RFLP) Restriction Fragment Length Polymorphism 1980 Botstein et al. polymorphisms due to changes in restriction sites or in DNA between sites

11 RFLP Restriction fragment length polymorphism Co-dominant Requires:
single copy DNA probe Restriction enzyme Southern blotting DNA polymorphism

12 Co-dominant marker Dominant marker Polymorphism -Parent 1 : one band
-Parent 2 : a smaller band -Offspring 1 : heterozygote = both bands -Offspring 2 : homozygote parent 1 P 2 P 1 O 2 O 1 Gel configuration Dominant marker Polymorphism Parent 1 : one band -Parent 2 : no band -Offspring 1 : homozygote parent 1 -Offspring 2 : ???? P 2 Gel configuration P 1 O 1 O 2

13 Inheritance of RFLPs 자손에게 유전

14 RFLP linkage analysis AA Aa aa
RFLPs provide useful markers for all of the human chromosomes disease genes can be mapped by searching for linkage between an RFLP and the disease phenotype RFLP probe disease gene A normal gene a the A/a polymorphism is linked to the disease-causing gene AA Aa aa AA homozygous for ‘A’ Aa heterozygous aa homozygous for ‘a’ This figure shows the linkage between an RFLP and a disease gene (the disease gene in most cases would be the result of a rare mutation). The larger 'A' fragment in this case is "linked" to the downstream disease gene. It should be emphasized that the RFLP in this case may be at quite a distance from the disease gene and may not have any relationship with the disease gene, except for the fact that it lies on the same chromosome. There may, in fact, be other genes lying between the RFLP and the disease gene (they, too, may not have any relevance to the disease phenotype). Most RFLPs are of this type - they are at a distance. However, it is also possible for RFLPs to lie close to or within disease genes, and they may actually be the result of the disease-causing mutation. In the example shown, Southern blotting followed by hybridization with the RFLP probe found that the 'A' allele is linked to the disease gene and that the 'a' allele is linked to the normal gene. Thus, an 'AA' individual in this family would be homozygous for the disease and an 'aa' individual would be homozygous for the normal state. If the disease was inherited in an autosomal recessive fashion, a heterozygous 'Aa' individual would be a non-affected carrier. If the disease was inherited in an autosomal dominant fashion, the heterozygous individual would be affected by the disease. In a dominant disease, AA and Aa would be affected In a recessive disease, AA would be affected and Aa would be a carrier

15 X affected child test subject mother father Aa Aa aa aa A a RFLP probe
normal gene A X recombination? disease gene a the test subject is determined to have the same genotype as its sibling and therefore can be predicted to get the disease the prediction must be qualified, however, because of the possibility of recombination between the polymorphic marker and the disease gene the frequency of recombination and therefore the reliability of the marker is dependent on the distance between the two sites affected child test subject mother father Aa Aa aa aa In this family, it has been established that allele 'a' is linked to the disease gene. This was confirmed by showing that one of the affected children is homozygous for the 'a' allele. The test subject is then tested and found to also be homozygous for the 'a' allele, predicting that it will also be affected by the disease. This prediction must be qualified, however, because of the possibility of recombination between the RFLP locus and the disease gene locus (shown by the X). The frequency of recombination between loci is generally related to the distance between them. Therefore, the closer the loci are together, the more reliable the prediction.

16 Genotype Determination using RFLP's and a Gene Probe
A DNA probe that hybridizes to the 5' end of the human beta globin gene (shown in blue on the diagram below) was used to identify RFLP pieces from members of a family in which sickle-cell hemoglobin (HbS) was segregating. The normal HB allele (HbA) is cut at three places by a particular restriction enzyme (positions shown with red arrows). The HbS mutation destroys the internal restriction site so the HbS gene is cut in only two places. Thus, the probe hybridizes to a 1.15 kb DNA fragment from HbA DNA and hybridizes to a 1.35 kb fragment from HbS DNA.

17 Restriction sites e.g. EcoR1 recognizes GAATTC and
cuts between G and A P1 P2

18 DNA taken from three individual animals, cut with a restriction enzyme and separated by gel electrophoresis... 23 KB 9.4 KB 6.7 KB 4.3 KB 2.3 KB 2.0 KB 0.6 KB

19 Autoradiograph of Southern blot produced from previous genomic DNA restiction digest, probed with a muscle actin gene probe... homozygote heterozygotes DNA polymorphism: 3 different “genotypes”

20 RFLP DNA cut with restriction enzyme, separated by size on an agarose gel, hybridized to a filter To see bands, probe with a labeled fragment of DNA probes = genomic clones, cDNAs, ESTs Labeled with 32P or fluorescence

21 RFLP techniques

22 P1 P2 Transfer to a membrane Probe with DNA fragment Southern Hybridization P1 P2 F1 F2

23 P1 P2 P1 P2 F1 F2

24 부모 자식들 P1 P2

25 RAPD Random Amplified Polymorphic DNA
임의증폭다형(Random Amplified Polymorphic DNAs, RAPD) RAPD Random Amplified Polymorphic DNA Williams et al. 1990 Amplify fragments of DNA using a SINGLE, RANDOM oligonucleotide primer (usually 10mer) Run out product on agarose gel, stain with ethidium bromide and visualize using UV Polymorphisms due to differences in and between primer annealing sites

26 Random Amplified Polymorphic DNA (RAPD)
Amplifies anonymous stretches of DNA using arbitrary primers Fast and easy method for detecting polymorphisms Domimant markers Reproducibility problems

27 Random Amplified Polymorphic DNA (RAPD)
PCR products on agarose gel C C/L C C/L C L L L Strain 1 Columbia Strain 2 Landsberg parental DNA mapping population 순수 혹은 잡종분별 5’ Primer Strain 1 Columbia GCCGTAGCAAGT 5’ 3’ CCGTACGTAGCAAGT-.....NNNNNNNNN___...ACTTGCGGCGTA GCCGTAGCAAGT 5’ Primer 5’ Strain 2 Landsberg GCCGTAGCAAGT 5’ 5’ CCGTACGTAGCAAGG-.....NNNNNNNNN___...ACTTGCGGCGTA

28 RAPD Polymorphisms among landraces of sorghum
Sequences of 10-mer RAPD primers Name Sequence OP A08 5’ –GTGACGTAGG- 3’ OP A15 5’ –TTCCGAACCC- 3’ OP A 17 5’ –GACCGCTTGT- 3’ OP A19 5’ –CAAACGTCGG- 3’ OP D02 5’ –GGACCCAACC- 3’ M RAPD gel configuration

29 Microsatellites (SSR)
초위성체에 의한 다형관찰법 (Simple Sequence Length Polymorphism, SSLP) Microsatellites (SSR) polymorphisms in the number of di-, tri-, tetra- or penta-nucleotide repeats scattered throughout the genome Often arise due to ‘stuttering’ during DNA synthesis or uneven pairing and crossing-over primers designed based on flanking DNA sequences Requires large amounts of sequencing to develop - $$$

30 R S S R AGTGCATGAGCGCGCGCGCGCGTCTCTATGTC
Parent 1 - resistant AGTGCATGAGCGCGCGCGCGCGTCTCTATGTC Parent 2 - susceptible AGTGCATGAGCGCGCGCGCGCGCGCGTCTCTATGTC R S S R

31 Microsatellites (SSR)
PCR products run out on agarose gels (if not too close in size) or more often, on polyacrylamide gels (if only a few bases separate the 2 genotypes Visualized by using labeled primers (radioactive or fluorescent) or with ethidium bromide or silver staining

32 SSR repeats and primers
GGT(5) Sequence GCGCCGAGTTCTAGGGTTTCGGAATTTGAACCGTC ATTGGGCGTCGGTGAAGAAGTCGCTTCCGTCGTTTGATTCCGGTCGTCAGAATCAGAATCAGAATCGATATGGTGGCAGTGGTGGTGGTGGTGGTGGTTTTGGTGGTGGTGAATCTAAGGCGGATGGAGTGGATAATTGGGCGGTTGGTAAGAAACCTCTTCCTGTTAG ATTCTGGAATGGAACCAGATCGCTGGTCTAGAGGTTCTGCTGTGGAACCA….. GAGGGCTGATGAGGTGGATA ATCTTATGGCGGTTCTCGTG

33 SSR polymorphisms AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGG P1
AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCG P2 P1 P2 Gel configuration

34 Genographer image of microsatellite sORB30 in a B. napus population
bp 207 169 sORB30 P1 P2 Agriculture and Agri-Food Canada

35 Simple Sequence Length Polymorphism (SSLP)
Reverse Primer Reverse Primer Forward Primer Forward Primer ACGT GA (GA)44 GA CCTG ACGT GA (GA)78 GA CCTG Strain 1 Columbia Strain 2 Landsberg PCR Strain 1 Columbia Strain 2 Landsberg

36 범인1 범인2 희생자

37 ? ? 엄마 형제자매 엄마 형제자매

38

39

40 ABI 377-96 microsatellite mapping gel
Agriculture and Agri-Food Canada

41

42 PCR hypervariable fragment of gene.
단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) (교재 ) Theory: the conformation of single-stranded DNA is dependent on its primary sequence Purpose: to electrophoretically separate PCR fragments that differ by a few bases. PCR hypervariable fragment of gene. Denature into single-strands by heating. Run on a polyacrylamide gel PCR products with different sequences will run a different speeds on the gel.

43 (Single Strand Conformation Polymorphisms, SSCP)
단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) Single strand conformation polymorphism analysis (SSCP), takes advantage of the secondary structure (conformation) of single stranded DNA. A mutation in a DNA strand may change the conformation of that strand. The mutant conformation may electrophorese differently to the wild type conformation.

44 단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) Denature Renature rapidly Wild type Mutant

45 단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) Wild type Mutant Electrophorese ss DNA ds DNA WT M

46 NT kid blood (Jinsoon) Recipient blood Donor cell line PCR- SSCP analysis of the second exon of the goat MHC class ll DRB gene PCR products were denatured at 80°C for 5 min and immediately chilled on ice for 2min. The samples were run for 3.5hrs on 10% polyacrylamide gels in 1% TBE buffer at 100V and the bands were visualized by ethidium bromide under the UV light.

47 SNPs (Single Nucleotide Polymorphisms)
Hybridization using fluorescent dyes SNPs on a DNA strand Any two unrelated individuals differ by one base pair every 1,000 or so, referred to as SNPs. Many SNPs have no effect on cell function and therefore can be used as molecular markers.

48 (Single Nucleotide Polymorphism)
SNP (Single Nucleotide Polymorphism) SNPs, the most common form of genetic polymorphism causing diversities among different individuals. SNPs are estimated to occur every bp (3,000,000 to 6,000,000 SNPs) To facilitate large scale genetic association studies Approximately 1,000,000 human SNP’s currently mapped Useful in pharmacogenomics, advanced disease screening studies, etc…

49 SNP Analysis SNP Discovery: Direct sequencing and comparative analysis
Quality Values CEQuence Investigator SNP Scoring: Rapid identification of known SNPs by microsequencing or primer extension CEQ or SNPstream Analysis Primer Extension chemistry

50 DNA polymorphism 분석에 의한 동물육종
개체에 의한 유전자형을 손쉽고 정확하게 파악하여 개체에 대한 육종가 추정 대동물에서 착상전 수정란의 성감별 유전병 등 열성형질을 제거하기 위한 종축집단 구축 육종 프로그램내의 혼선을 방지하기 위한 개체나 집단간의 혈연관계 확인 형질관련 유전자의 분리를 위한 도구로서 유전자 지도 작성시의 이용

51 Marker Assisted Selection
Breeding for specific traits in plants and animals is expensive and time consuming The progeny often need to reach maturity before a determination of the success of the cross can be made The greater the complexity of the trait, the more time and effort needed to achieve a desirable result.

52 Marker Assisted Selection(MAS)
The goal to MAS is to reduce the time needed to determine if the progeny have trait The second goal is to reduce costs associated with screening for traits If you can detect the distinguishing trait at the DNA level you can identify positive selection very early.

53 Developing a Marker Best marker is DNA sequence responsible for phenotype i.e. gene If you know the gene responsible and has been isolated, compare sequence of wild-type and mutant DNA Develop specific primers to gene that will distinguish the two forms

54 Developing a Marker If gene is unknown, screen contrasting populations
Use populations rather than individuals Need to “blend” genetic differences between individual other than trait of interest

55 Developing Markers Cross individual differing in trait you wish to develop a marker Collect progeny and self or polycross the progeny Collect and select the F2 generation for the trait you are interested in Select individuals in the F2 showing each trait

56 Developing Markers Extract DNA from selected F2s
Pool equal amounts of DNA from each individual into two samples - one for each trait Screen pooled or “bulked” DNA with what method of marker method you wish to use Method is called “Bulked Segregant Analysis”

57 Marker Development Other methods to develop population for markers exist but are more expensive and slower to develop Near Isogenic Lines, Recombinant Inbreeds, Single Seed Decent What is the advantage to markers in breeding?

58

59 Capillary Electrophoresis: The Basic Design
Dideoxy-terminator labeled fragments are heated in plate to denature. Current is applied across the capillary, and charged fragments are drawn into capillary. Fragments migrate according to size through capillary. As fragments pass detector window, diode lasers excite dye terminators. Dye terminators fluoresce. Filter wheel masks spurious signal. Filtered signal excites photomultiplier tube (pmt). Software interprets signal and calls bases 3 2 1

60 CEQ Applications: Fragment Analysis 2) DNA Sequencing
STR/SSR/Microsatellite Analysis Amplified Fragment Length Polymorphism (AFLP) Random Fragment Length Polymorphism (RFLP) Loss of Heterozygosity (LOH) MI (Micro satellite Instability) SNP Genotyping Gene Expression Other sizing, peak ratio/quantitation applications 2) DNA Sequencing Short PCR (75 – 300 bp in 25 minutes) Long Fast (700 – 900 bp in 80 minutes) Extended Read Lengths (increase reads by 20% - over 1000 bp)

61 Benefits of Optimization with CE:
Can modify methods For high signal = inject less For low signal = inject more For short template = decrease separation time For longer template = increase separation time Re-run samples at many different methods (with limitations!!!!)

62 CEQ 8000 Series: Hardware Fully Automated

63 CEQTM One Gel, One Array, One Software
Perform sequencing and fragment sizing applications without changing gels, capillaries, or plates! Gel cartridge- preloaded syringe, linearized polyacrylamide (LPA), nontoxic Capillary array- patented fixed coating eliminates electrosmotic flow (EOF)

64 CEQTM Well-Red Dyes- Designed for CE
Minimal spectral overlap superior resolution Infrared dyes low intrinsic background with no interference from biological components Similar sizes and mobilities move optimally in a capillary array Minimal Spectral overlap means greater resolution. Think of it like swimming in murky waters. The more dirt the more interference in your eyes, the harder it is to navigate where you are going. This is essentially what the spectral overlap represents. The less overlap the better the resolution the better the data analysis. Also, Well-Red dyes read in the near infra red region. This eliminates the large biological interference that naturally occurs using he dyes red in the Blue/green region…like Big Dye chemistry. All naturally occurring organisms are red in that region meaning there is far more intrinsic background. This cuts down on resolution and limits the ability of the instrument. Because the Well-Red dye have such low background, they can detect things like heterzygocity which require much greater sensitivity and resolution.

65

66 Loss of Heterozygosity (LOH)
Cancer Research Heterozygosity: the status that the two copies of a gene or non-gene segment at a locus have different sequences Heterozygous PCR CEQ

67 Loss of Heterozygosity (LOH) in Cancer
Abnormalities (deletions) through mutagenesis

68

69 Amplified Fragment Length Polymorphisms
AFLP (and RFLP) reveal the DNA fragment length polymorphisms due to mutation at restriction sites or any insertion or deletion between two restriction sites. Why Use AFLP (or RFLP)? Rapid analysis of unknown genome without sequence knowledge Identification of different species Relationship study Genome wide genotyping High discriminatory power and relatively easy to perform.

70 AFLP Theory AFLP: Amplified Fragment Length Polymorphism
Mutations at restriction enzyme cutting sites result in fragment length polymorphism Ligation of adapters to genomic restriction fragments Selective PCR amplification with adapter-specific primers Adapters and amplification w/ selective primers are the keys in AFLP

71 AFLP -How It Works: Fragment length polymorphism due to:
Mutation at restriction sites Insertions or deletions between restriction sites Mutation adjacent to restriction sites and complementary to the selective primer extension

72

73 (Single Nucleotide Polymorphism)
SNP (Single Nucleotide Polymorphism) SNPs, the most common form of genetic polymorphism causing diversities among different individuals. SNPs are estimated to occur every bp (3,000,000 to 6,000,000 SNPs) To facilitate large scale genetic association studies Approximately 1,000,000 human SNP’s currently mapped Useful in pharmacogenomics, advanced disease screening studies, etc…

74 SNP Analysis SNP Discovery: Direct sequencing and comparative analysis
Quality Values CEQuence Investigator SNP Scoring: Rapid identification of known SNPs by microsequencing or primer extension CEQ or SNPstream Analysis Primer Extension chemistry

75 Life Cycle of a SNP CEQ 8000 and 8800: 1 – 4,600 SNP’s
SNPstream: 4,600 – 800,000 SNP’s

76 Primer Extension Technology:
The Genotyping Gold Standard function Detect Purpose: Reinforce simplicity of the fundamental chemistry and set stage for tag-array description – SIMPLE AND HIGHLY ACCURATE. First, the primer complimentary to the target sequence adjacent to the SNP site, hybridizes to the pre-amplified DNA. This is the first level of specificity inherent in the reaction and enhances the previous specificity from the PCR amplification primers. The extension primer is next extended enzymatically with a labeled terminating nucleotide at the target SNP site. The terminating nature of the nucleotides limits extension to only one base. The combination of the fidelity of the polymerase and its sensitivity to 3’ mismatches produces the second level of SNP-IT specificity and ensures a highly accurate genotyping result. The labeled nucleotide on the extended SNP-IT primer is then detected. The readout method is dependent only on the type of labeled terminator used – in SNP Stream it is fluorescent with a ccd camera.  Detect: Fluorescence Anneal: Simple Primer Extension Extend: Accurate “lock and key” enzyme

77 Primer Extension Technology

78 Multiplexed SNP’s on the CEQ 8800

79 Visualize Manage genetic study data including genotypic, clinical,
and phenotypic information and pedigrees. Create and view customizable, interactive pedigrees. Explore genotypic and phenotypic patterns with advanced visualization tools. Perform population statistical analyses including allele and genotype frequencies, Hardy-Weinberg equilibrium, and chi-squared analysis.


Download ppt "제5장 동물 분자육종을 위한 DNA 표지인자의 이용"

Similar presentations


Ads by Google