Presentation is loading. Please wait.

Presentation is loading. Please wait.

Ruby in 20 minutes John Pinney

Similar presentations


Presentation on theme: "Ruby in 20 minutes John Pinney"— Presentation transcript:

1 Ruby in 20 minutes John Pinney

2 What is Ruby? A true object-oriented language with easily understandable syntax and convenient notations. => pure / elegant / powerful “I wanted a scripting language that was more powerful than Perl, and more object-oriented than Python.” Yukihiro Matsumoto (“Matz”)

3 The Ruby interpreter > irb puts "Hello World" Hello World

4 (Almost) everything is an object There are no primitives in Ruby. Nearly everything can be considered as an object, i.e. is an instance of a class has an interface for method invocation

5 "hello".reverse => "olleh” 44.even? => true nil.class => NilClass nil.class.class => Class

6 Parts of speech Variables Numbers Strings Symbols Constants Ranges Regular Expressions Methods + arguments Blocks + arguments Arrays Hashes Operators Keywords

7 Variables local_variable = = 4.6 = 8.9 = “attribute”) $global_variable = 2.5

8 Numbers 1.class => Fixnum 1.0.class => Float

9 Symbols Symbols (starting with a colon ) are like lightweight strings. They always point to the same object, wherever used in the code. x = :my_symbol

10 Methods front_door.open front_door.open.close front_door.is_open? front_door.paint(3,:red) front_door.paint(3,:red).dry(30).close

11 Kernel methods are invoked by their names alone. This is just a bit of syntactic sugar. print "Hello\n" Hello Kernel.print("Hello\n") Hello ( print is really a class method of Kernel )

12 Operators behave as you would expect: But in Ruby they are actually methods! 1.+(2) 3 Since all operators are methods, they can be defined as you like for your own classes, or even re-defined for existing classes. Operators

13 Blocks Any code surrounded by curly braces is a closure, known as a block: 20.times{ print 'CAG' } CAGCAGCAGCAGCAGCAGCAGCAGCAGC AGCAGCAGCAGCAGCAGCAGCAGCAGCA GCAG Blocks are sets of instructions that can be passed around the program.

14 Blocks can also take arguments, delimited by pipe characters: "Hello".each_char{|ch| puts ch} H e l o

15 Braces can be replaced by the keywords do and end. "Hello".each_char do |ch| puts ch end H e l o

16 Effective use of blocks can allow highly transparent code: a = [ "a", "b", "c", "d" ] a.collect { |x| x + "!" } ["a!", "b!", "c!", "d!"]

17 Regular expressions Regex is very simple to use in Ruby (much nicer than Python!) text = "Cats are smarter than dogs”; if ( text =~ /(C|c)at(.*)/ ) then puts "I found a cat" end I found a cat

18 Example class Greeter def initialize(name = = name end def say_hi puts "Hi end def say_bye puts "Bye come back soon." end

19 g = Greeter.new("Pat") g.say_hi Hi Pat! g.say_bye Bye Pat, come back soon. g.name NoMethodError: undefined method 'name' for #

20 class Greeter attr_accessor :name end g.name => "Pat" g.name = "John" g.say_hi Hi John!

21 Sources: https://www.ruby- lang.org/en/documentation/quickstart/


Download ppt "Ruby in 20 minutes John Pinney"

Similar presentations


Ads by Google