Presentation is loading. Please wait.

Presentation is loading. Please wait.

Bars with different colors are different at the Tukey’s HSD test (P=0.05) Avena genetic resources for quality in human consumption (AVEQ) WP5,Fusarium.

Similar presentations


Presentation on theme: "Bars with different colors are different at the Tukey’s HSD test (P=0.05) Avena genetic resources for quality in human consumption (AVEQ) WP5,Fusarium."— Presentation transcript:

1 Bars with different colors are different at the Tukey’s HSD test (P=0.05) Avena genetic resources for quality in human consumption (AVEQ) WP5,Fusarium and Mycotoxins analysis. 1.Samples from artificial inoculation of Fusarium spp. in field tests of Germany, Czech Republic and Romania. 2.Natural infection in Northern Italy field test. 3. ELISA test for DON and T-2 detection 4.qPCR analysis on a subset of samples to quantify Fusarium CRA-GPG (ex Experimental Institute for Cereal Research), Fiorenzuola d’Arda, Italy Valeria Terzi, Caterina Morcia

2 ELISA test for mycotoxin detection 127 samples from Fusarium Screening 2008 in Gross Lusewitz ELISA tests for DON on these 127 samples are ongoing ELISA tests for T2 on these 127 samples? Starting from the results obtained we can select a set of genotypes grown in Northern Italy, under natural infection, and evaluate them for DON

3

4 Barley FiorenzuolaTolentino Triticale DON survey in other cereals, 2008

5 Specie fungina Sequenza 5’-3’Riferimento bibliografico F.culmorum Primer Forward TCACCCAAGACGGGAATGA Primer Reverse GAACGCTGCCCTCAAGCTT probe CACTTGGATATATTTCC Waalwijk C, van der Heide R, de Vries I, van der Lee T, Schoen C, Costel-de Corainville G, Hausen-Hahn I, Kastelein P, Kohl J, Lonnet P, Demarquet T, Kema GHJ (2004) Eur J Plant Pathol 110: F.graminearum Primer Forward GGCGCTTCTCGTGAACACA Primer ReverseGGCTAAACAGCACGAATGC probe AGATATGTCTCTTCAAGTCT Waalwijk C, van der Heide R, de Vries I, van der Lee T, Schoen C, Costel-de Corainville G, Hausen-Hahn I, Kastelein P, Kohl J, Lonnet P, Demarquet T, Kema GHJ (2004) Eur J Plant Pathol 110: F.culmorum Primer Forward ATGGTGAACTCGTCGTGGC Primer Reverse CCCTTCTTACGCCAATCTTCG Nicholson P, Simpson DR, Weston G, Rezanoor HN, Lees AK, Parry DW, Joyce D (1998) Physiol Mol Plant Pathol 53: Demeke T, Clear RM, Patrick SK, Gaba D (2005) Int J Food Microbiol 103: F.graminearum Primer Forward CTCCGGATATGTTGCGTCAA Primer Reverse GGTAGGTATCCGACATGGCAA Nicholson P, Simpson DR, Weston G, Rezanoor HN, Lees AK, Parry DW, Joyce D (1998) Physiol Mol Plant Pathol 53: Brandffass C, Karlovsky (2006) BMC Microbiology 6:4 doi: / /6/4 Demeke T, Clear RM, Patrick SK, Gaba D (2005) Int J Food Microbiol 103: F.graminearum Primer Forward GGTCTCGACAGCAATGGTGTT Primer Reverse GCTTGTGTTTTTCGTGGCAGT probe ACAACGGCACCTCTGAGCTCCAGC Reischer GH, Lemmens M, Farnleitner A, Adler A, Mach RL (2004), 59(1): F.culmorum Primer Forward GATGCCAGACCAAGACGAAG Primer Reverse GATGCCAGACGCACTAAGAT Schilling AG, Moller EM, Geiger HH (1996) Phytopathol 86: Brandffass C, Karlovsky (2006) BMC Microbiology 6:4 doi: / /6/4 F.culmorum F.graminearum Primer Forward CAAAAGCTTCCCGAGTGTGTC Primer Reverse GGCGAAGGTTCAAGGATGAC Leisova L, Kucera L, Chrpova J, Sykorova S, Sıp V, Ovesna J (2006) J Phytopathol 154: 603–611 F.culmorum Primer Forward TTCACTAGATCGTCCGGCAG Primer Reverse GAGCCCTCCAAGCGAGAAG probe AAAGAAGTTGCAATGTTAGTG Leisova L, Kucera L, Chrpova J, Sykorova S, Sıp V, Ovesna J (2006) J Phytopathol 154: 603–611 F.culmorum Primer Forward GTACCAGAGCAC GGC GTTG Primer Reverse TCGCTCTCGATCAAAAGAAGG probe ACAAGTCCCCTCGACGTG Leisova L, Kucera L, Chrpova J, Sykorova S, Sıp V, Ovesna J (2006) J Phytopathol 154: 603–611 F.graminearum Primer Forward AGGGACAATAAGTGCAGA Primer Reverse ACTGTGCACTGTCGCAAGTG Niessen L, Vogel RF (1997) Syst Appl Microbiol 20: Fusarium spp. Primer Forward GCTGCTCATCACTTTGCTCAG Primer Reverse CTGATCTGGTCACGCTCATC Niessen L, Vogel RF (1997) Syst Appl Microbiol 21: Schnerr H, Niessen L, Vogel R F (2001) Int Jf Food Microbiol 71:53–61 Fusarium spp. Primer Forward TGATTTACATGGAGGCCGAATCTCA Primer Reverse TTCGAATGTTGGTGATTCATAGTCGTT probe TTGCCCCTCTTTGATCGAGTTGCGTCTCCC Bluhm BH, Cousin MA, Woloshuk (2004) J Food Protect 67(3):

6 Kimura et al, 2007 tacttcgtcg acatggggga gtaaccgccg tttcccgccc cttgttaagc taagcgtttt 2581 taatatggaa aacggagttc atctacagta gagtcgacaa gatctgcaat ctatcagtgc 2641 ttaaatgcag ttccagctac gcgactttca ggcaccggca atggagatct tggctcagat 2701 tctagtctaa ctaacacata ggaaaggggt tgtagatcgt acagctaaat tcagagcctc 2761 ctgctaaacc taaaagggct aagttgccca aactttattc aacgcagttg cagtgcattc 2821 gggagccaac tccgcgggat atatgtgatg gccggcagtt tcgtagtgct gatcataaaa 2881 gtggtcatat ttaaggcctg tcgcccaggt agacttttgc cagggcacaa tataacaccg 2941 cggctaccta ggtaagtgag gctttcttct gtgttgatag acggtcgttt cactagtcca 3001 aacacagacc acggacaatg accgaactca atatcccgat ccaaggattg atccctagat 3061 ttaggcctac

7 F. graminearum: MPVP74, ITEM2, ITEM124, ITEM126, ITEM646, ITEM2724, ITEM4576, ITEM6350, ITEM6403,ITEM6477, ITEM6484, ITEM6613 F. culmorum: MPVP69, MPVP70, MPVP71, ITEM 2, ITEM 3, ITEM 5, ITEM 6, ITEM7, ITEM8, ITEM 9, ITEM 11, ITEM12, ITEM 13, ITEM 15, ITEM 16, ITEM 17, ITEM 18, ITEM 19,ITEM 21, ITEM 22, ITEM 23, ITEM 24, ITEM 25, ITEM 32 F. poae: MPVP90 F. avenaceum: MPVP66 F. verticilloides: MPVP228 Microchodium nivale: MPVP77

8 3 bread wheat cv 3 durum wheat cv 2 years Inoculation with F. graminearum (2 strains) Inoculation with F. culmorum (3 strains) 6 developmental stages

9

10 Bars with different colors are different at the Tukey’s HSD test (P=0.05) qPCR based Fusarium traceability in raw materials and food.

11 The qPCR assay made it possible to detect differences between infection periods better than fungal isolation from kernels with classical mycological methods. Fusarium traceability for early diagnosis 2 bread wheat cv 2 durum wheat cv In pots Inoculation with F. graminearum Inoculation with F. culmorum Flowering stage (65 BBCH) Samples from 6hours from inoculation to 12 days

12 Bars with different colors are different at the Tukey’s HSD test (P=0.05) Avena genetic resources for quality in human consumption (AVEQ) qPCR based Fusarium traceability 1.We have checked our qPCR assay on strains fromCzech Republic and Germany. It works for F.culmorum and graminearum. 2.Preliminary qPCR analysis was done on a set of oat samples from Czech Republic.

13 Bars with different colors are different at the Tukey’s HSD test (P=0.05) Avena genetic resources for quality in human consumption (AVEQ) qPCR based Fusarium traceability 1.2. We’ll apply the assay to 11 standard cv, inoculated and non inoculated 3. PCR results will be gathered with ELISA results 4. Starting from the results, it will be evaluated to expand the PCR assays.


Download ppt "Bars with different colors are different at the Tukey’s HSD test (P=0.05) Avena genetic resources for quality in human consumption (AVEQ) WP5,Fusarium."

Similar presentations


Ads by Google