Presentation is loading. Please wait.

Presentation is loading. Please wait.


Similar presentations

Presentation on theme: "EVOLUTION OF BIOLOGICAL REGULATORY NETWORKS J. Demongeot AGIM, CNRS/UJF Grenoble 26/11/2011Valparaiso."— Presentation transcript:


2 26/11/2011Valparaiso

3 26/11/2011Valparaiso Robustness - Role of circuits - Role of n-switches - Role of microRNAs - Role of viruses - Don’t forget resilience JD, E. G OLES, M. M ORVAN, M. N OUAL & S. S ENÉ Attraction Basins as Gauges of Environmental Robustness in Biological Complex Systems. PloS ONE, 5, e11793 (2010). - Don’t forget resistance JJD & S. S ENÉ The singular power of the environment on nonlinear Hopfield networks. In : CMSB’11, ACM Proceedings, New York, 55-64 (2011).

4 RAG control network C. Georgescu et al. PNAS 2008 Valparaiso26/11/2011

5 V(D)J Recombination Mechanism Germinal Configuration Jm C Vn TCRα V-J Réarrangement V(D)J Recombinase RAG (Recombination Activating gene) TREC T-cell-Receptor Excisional Circle gene N. P ASQUAL ET AL. J. Exp. Medicine, 196, 1163-1174 (2002) T.P. B AUM ET AL. BMC Bioinformatics, 7, 224-228 (2006) F. T HUDEROZ ET AL. PLoS Comp. Biol., 6, e1000682 (2010) Valparaiso26/11/2011

6 V and J gene use: Experimental quantifications in BalbC mouse Proximal V Genes Distal V Genes Diversity of the TCR α Combinatorial Repertoire Peripheral TRAV 21 TRAV 1 TRAV14-1 TRAV14-2 TRAV14-3 TRAV14-D1 TRAV14-D2 TRAV14-D3 Valparaiso26/11/2011

7 Negative 6 Negative 2 Valparaiso 26/11/2011

8 JD et al. Journal of Theoretical Biology 280, 19-33 (2011) F. Thuderoz et al. PloS Comp. Biol. 6 (2010) T.P. Baum et al. Nucleic Acids Res. 32, 51-54 (2004). Valparaiso 26/11/2011 Runx1 R

9 Parallel iterations Valparaiso 26/11/2011 Noual, JD, Sené DAM (accepted)

10 Valparaiso l = 3 × r / 2 26/11/2011

11 Valparaiso Positive circuits Negative circuits

12 26/11/2011Valparaiso Frustration

13 26/11/2011Valparaiso

14 26/11/2011Valparaiso

15 26/11/2011Valparaiso

16 Overview of mRNA and miRNA Processing mRNA/miRNA pairing RNA binding oligopeptide Non coding DNA Coding DNA pre-miRNA hairpin Drosha Enzyme Exportine-5 miRNA CATG GTAC GUAC tRNAs mRNA pri-miRNA RISC Valparaiso26/11/2011

17 Valparaiso H.I. Suzuki et al., J. Mol. Med. 2010 mitochondrion 26/11/2011 target tRNA

18 Valparaiso26/11/2011

19 5’ GAUUAGGGUGCUUAGCUGUUAA 3’ MIR 1977 (A. Henrion-Caude, Mirifix, PLoS ONE 2011, JD et al. ECAL, MIT Press 2011) G G U C U A U U C U U G G G G A U U A A G Valparaiso A 26/11/2011

20 NOT CODING MITOCHONDRIAL DNA 5’ AUCUGGUUCUUACUUCAGGGC mitomir 10 Central 116 RARYGGUACU RRYUUCRARYU tRNA Lewin AUCUGGUUCU UACUUCAGGAC mitomir 12 CSB D 353 mitomir 10 E. Sbisa Gene 205 (1997) mitomir 12 P. Cui BMC Genomics 8 (2007) Valparaiso 26/11/2011 R = A or G; Y = U or C

21 26/11/2011Valparaiso

22 Anatomie virale

23 ‘Patient Zero H1N1’ (5 ans) Edgar Hernandez



26 26/11/2011Valparaiso

27 26/11/2011Valparaiso

28 26/11/2011Valparaiso

29 + + Negative circuit of size 3 Valparaiso 26/11/2011

30 Valparaiso miR G1G1 G2G2 G3G3 G1G1 G2G2 G3G3 G1G1 G2G2 G3G3 Persistence of rhythm in case of weak inhibition miR inhibition with parallel updating miR inhibition with parallel updating Negative 3-switch  Positive circuits 26/11/2011

31 Valparaiso

32 26/11/2011

33 Valparaiso

34 26/11/2011Valparaiso

35 26/11/2011Valparaiso

36 26/11/2011Valparaiso

37 26/11/2011Valparaiso

38 26/11/2011Valparaiso

39 26/11/2011Valparaiso

40 26/11/2011Valparaiso [27] M. Cosnard, E. Goles, Discrete states neural networks and energies, Neural Networks 10 (1997) 327-34 XnXn X1X1 X2X2 XiXi -1 -1...... +-

41 Valparaiso26/11/2011

42 Engrailed network Valparaiso26/11/2011

43 Valparaiso26/11/2011

44 Valparaiso

45 p27, Cdk2, pCyCE Cdk2, CyCE Cdk2, miRNA159, pCycA Cdk2, CycA Cdk2, Rbp-E2F, Rb-E2F, E2F, Rbp, Rb Cell cycle control miRNA 34 Coherent feed-forward double path Double positive loop p53 Parallel Sequential Valparaiso L. He et al. Nature 447, 1130-1134 (2007) 26/11/2011

46 Valparaiso miRNA159=1 Parallel updating

47 26/11/2011Valparaiso

48 26/11/2011ValparaisoConclusion Robustness - Role of circuits - Role of n-switches - Role of microRNAs - Role of viruses - Don’t forget resilience JD, E. G OLES, M. M ORVAN, M. N OUAL & S. S ENÉ Attraction Basins as Gauges of Environmental Robustness in Biological Complex Systems. PloS ONE, 5, e11793 (2010). - Don’t forget resistance JJD & S. S ENÉ The singular power of the environment on nonlinear Hopfield networks. In : CMSB’11, ACM Proceedings, New York, 55-64 (2011).

Download ppt "EVOLUTION OF BIOLOGICAL REGULATORY NETWORKS J. Demongeot AGIM, CNRS/UJF Grenoble 26/11/2011Valparaiso."

Similar presentations

Ads by Google