Presentation is loading. Please wait.

Presentation is loading. Please wait.

Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA.

Similar presentations


Presentation on theme: "Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA."— Presentation transcript:

1 Forensic DNA Analysis (Part I)

2 Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA and Statistics

3 What is DNA?

4 What does DNA stand for? What does DNA do?  DNA contains genetic information.  DNA codes for the proteins our bodies make that are necessary for survival. Deoxyribose Nucleic Acid or Deoxyribonucleic Acid

5 What is DNA? DNA is a code for making proteins. AGC TAG CTT ATA CTC TAT CTC TTT Amino Acid Amino Acid Amino Acid Amino Acid Amino Acid Amino Acid The order of amino acids determines what type of protein is made.

6 Some common proteins are:  Hemoglobin - carries oxygen from lungs to cells  Insulin - regulates metabolism  Many types of enzymes - catalyze reactions in the body, such as the breakdown of sugar for energy DNA also determines how much of these proteins each cell makes. What is DNA?

7 What does DNA look like? Double Helix Like a Twisted Ladder What is DNA?

8 Sugar Phosphate Backbone (Sides of Ladder) Nitrogenous Base (Rungs of Ladder) What is DNA? What does DNA look like?

9 The DNA ladder is made up of building blocks called nucleotides. What is a nucleotide? Phosphate Group Deoxyribose sugar Base Adenine Cytosine Guanine Thymine What is DNA?

10 The 4 Bases A Adenine G Guanine C Cytosine T Thymine What is DNA?

11 G C T A The 4 Bases

12 A pairs with T G pairs with C The bases pair up to form the rungs of the ladder. What is DNA? The 4 Bases

13 DNA is written as the sequence of these bases: AAGTCGATCGATCATCGATCATACGT What is DNA?  Only one side of the ladder is written.  In humans, there are three billion (3,000,000,000) base pairs (letters) in the DNA within each cell.

14 Among humans, most of the 3 billion bases in the DNA sequence are exactly the same.  Our Human DNA is 99.8% similar to each other, but the 0.2% difference is more than enough to distinguish us from one another.  NO TWO PEOPLE HAVE IDENTICAL DNA* *except identical twins What is DNA?  Human DNA is even 98% similar to chimpanzees.

15  If two different people started reciting their individual genetic code at a rate of one letter per second, it would take almost eight and a half minutes before they reached a difference.  If unwound and tied together, the strands of DNA in one cell would stretch almost six feet but would be only 50 trillionths of an inch wide.  If all the DNA in your body was put end to end, it would reach to the sun and back over 600 times (100 trillion times six feet divided by 92 million miles). What is DNA? Stupid Facts:

16 Where is DNA?

17 DNA is found in the cells in our body. Nucleus (Brain of the cell) Mitochondria (more later)

18 K-Fed sez: Quiz on Monday.

19 All types of cells in our body contain a copy of the same DNA.* Some cells important to forensic science are: White Blood Cell *Sperm CellCheek Cell Where is DNA?

20 DNA in the nucleus is packaged into Chromosomes. Where is DNA?

21 (one from Mother) (one from Father) Chromosomes come in pairs There are 46 chromosomes in each cell. (23 pairs) Where is DNA?

22 What are sources of DNA at a crime scene? DNA can be recovered from any substance that contains cells. Where is DNA?  Blood  Semen  Saliva  Tissue  Bone  Teeth  Hair  Maggot Crops

23 Maggot Crop Where is DNA?

24 How does DNA differ among Humans?

25 DNA is a sequence of 4 possible letters GACT Of the 3 billion letters, 99.8% of the sequence in all humans is identical. There are several ways the sequence can be different. How does DNA differ among humans? 

26 1. One of the bases (letters) can be different. Person 2 AGCTAGATCGTCATTCCGAG Person 1 AGCTAGATCGTTATTCCGAG How does DNA differ among humans?

27 Person 1 AGCTAGATCGTTATTCCGAG Person 2 AGCTAGATCGTATTCCGAG Person 3 AGCTAGATCGTTTATTCCGAG Person 4 AGCTCCGAG How does DNA differ among humans? 2. Bases (letters) can be added or removed.

28 Person 1 AGCTAGATCGTTATTCCGAG Person 2 AGCTAGATCGTATTCCGAG Person 3 AGCTAGATCGTTTATTCCGAG Person 4 AGCTCCGAG How does DNA differ among humans? 2. Bases (letters) can be added or removed.

29 Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. How does DNA differ among humans? 3. Regions of DNA can be repeated a different # of times.

30 How does DNA differ among humans? 3. Regions of DNA can be repeated a different # of times. Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT Person 2..GCCAGCTAGCTAGCTAGCTAGCTTTCAT.. Person 3..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT


Download ppt "Forensic DNA Analysis (Part I). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA."

Similar presentations


Ads by Google