Presentation is loading. Please wait.

Presentation is loading. Please wait.

AP Biology 2005-2006 Chapter 17. From Gene to Protein.

Similar presentations

Presentation on theme: "AP Biology 2005-2006 Chapter 17. From Gene to Protein."— Presentation transcript:


2 AP Biology Chapter 17. From Gene to Protein

3 AP Biology Metabolism teaches us about genes Metabolic defects studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria) each disease is caused by non-functional enzyme ABCDE Genes create phenotype

4 AP Biology

5 AP Biology gene – 1 enzyme hypothesis Beadle & Tatum Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments X-rays break DNA inactivate a gene wild type grows on minimal media sugars + required precursor nutrient to synthesize essential amino acids mutants require added amino acids each type of mutant lacks a certain enzyme needed to produce a certain amino acid non-functional enzyme = broken gene

6 AP Biology Beadle & Tatum 1941 | 1958 George Beadle Edward Tatum

7 AP Biology Beadle & Tatums Neurospora experiment

8 AP Biology So… What is a gene? One gene – one enzyme but not all proteins are enzymes but all proteins are coded by genes One gene – one protein but many proteins are composed of several polypeptides but each polypeptide has its own gene One gene – one polypeptide but many genes only code for RNA One gene – one product but many genes code for more than one product … Where does that leave us ?!

9 AP Biology Defining a gene… Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications. – Elizabeth Pennisi, Science 2003 gene polypeptide 1 polypeptide 2 polypeptide 3 RNA gene Its hard to hunt for wabbits, if you dont know what a wabbit looks like.

10 AP Biology proteinRNA The Central Dogma DNA transcriptiontranslation replication How do we move information from DNA to proteins? For simplicity sake, lets go back to genes that code for proteins…

11 AP Biology From nucleus to cytoplasm… Where are the genes? genes are on chromosomes in nucleus Where are proteins synthesized? proteins made in cytoplasm by ribosomes How does the information get from nucleus to cytoplasm? messenger RNA nucleus

12 AP Biology RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded mRNA, rRNA, tRNA, siRNA…. RNADNA transcription

13 AP Biology Transcription Transcribed DNA strand = template strand untranscribed DNA strand = coding strand Synthesis of complementary RNA strand transcription bubble Enzyme RNA polymerase

14 AP Biology Role of promoter 1. Where to start reading = starting point 2. Which strand to read = template strand 3. Direction on DNA = always reads DNA 3' 5' Transcription in Prokaryotes Initiation RNA polymerase binds to promoter sequence on DNA

15 AP Biology Transcription in Prokaryotes Promoter sequences RNA polymerase molecules bound to bacterial DNA

16 AP Biology Transcription in Prokaryotes Elongation RNA polymerase unwinds DNA ~20 base pairs at a time reads DNA 3 5 builds RNA 5 3 (the energy governs the synthesis!) No proofreading 1 error/10 5 bases many copies short life not worth it!

17 AP Biology Transcription RNA

18 AP Biology Transcription in Prokaryotes Termination RNA polymerase stops at termination sequence mRNA leaves nucleus through pores RNA GC hairpin turn

19 AP Biology Transcription in Eukaryotes

20 AP Biology Prokaryote vs. Eukaryote genes Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence

21 AP Biology Transcription in Eukaryotes 3 RNA polymerase enzymes RNA polymerase I only transcribes rRNA genes RNA polymerase I I transcribes genes into mRNA RNA polymerase I I I only transcribes rRNA genes each has a specific promoter sequence it recognizes

22 AP Biology Transcription in Eukaryotes Initiation complex transcription factors bind to promoter region upstream of gene proteins which bind to DNA & turn on or off transcription TATA box binding site only then does RNA polymerase bind to DNA

23 AP Biology A A A A A 3' poly-A tail CH 3 mRNA 5' 5' cap 3' G PPP Post-transcriptional processing Primary transcript eukaryotic mRNA needs work after transcription Protect mRNA from RNase enzymes in cytoplasm add 5' cap add polyA tail Edit out introns eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA As

24 AP Biology Transcription to translation Differences between prokaryotes & eukaryotes time & physical separation between processes RNA processing

25 AP Biology Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing needed

26 AP Biology mRNA From gene to protein DNA transcription nucleus cytoplasm mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA a a a a a a aa ribosome protein translation

27 AP Biology How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

28 AP Biology Cracking the code Nirenberg & Matthaei determined 1 st codon–amino acid match UUU coded for phenylalanine created artificial poly(U) mRNA added mRNA to test tube of ribosomes, tRNA & amino acids mRNA synthesized single amino acid polypeptide chain 1960 | 1968 phe–phe–phe–phe–phe–phe

29 AP Biology Marshall NirenbergHeinrich Matthaei

30 AP Biology Translation Codons blocks of 3 nucleotides decoded into the sequence of amino acids


32 AP Biology The code For ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid Why is this a good thing? Start codon AUG methionine Stop codons UGA, UAA, UAG

33 AP Biology How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon 5'3' 5' 3'5' UAC Met GCA Arg CAU Val

34 AP Biology protein transcription cytoplasm nucleus translation

35 AP Biology tRNA structure Clover leaf structure anticodon on clover leaf end amino acid attached on 3' end

36 AP Biology Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA endergonic reaction ATP AMP energy stored in tRNA-amino acid bond unstable so it can release amino acid at ribosome

37 AP Biology Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small

38 AP Biology Ribosomes P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain E site (exit site) empty tRNA leaves ribosome from exit site

39 AP Biology Building a polypeptide Initiation brings together mRNA, ribosome subunits, proteins & initiator tRNA Elongation Termination

40 AP Biology Elongation: growing a polypeptide

41 AP Biology Termination: release polypeptide Release factor release protein bonds to A site bonds water molecule to polypeptide chain Now what happens to the polypeptide?

42 AP Biology Protein targeting Signal peptide address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm start of a secretory pathway

43 AP Biology Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' cap polyA tail large subunit small subunit aminoacyl tRNA synthetase EPA 5' 3' RNA polymerase exon intron tRNA

44 AP Biology Put it all together…

45 AP Biology Any Questions??

46 AP Biology Chapter 17. Mutations

47 AP Biology Code is redundant several codons for each amino acid wobble in the tRNA wobble in the aminoacyl-tRNA synthetase enzyme that loads the tRNA Universal code

48 AP Biology Mutations When do mutations affect the next generation? Point mutations single base change base-pair substitution silent mutation no amino acid change redundancy in code missense change amino acid nonsense change to stop codon

49 AP Biology Point mutation leads to Sickle cell anemia What kind of mutation?

50 AP Biology Sickle cell anemia

51 AP Biology Mutations Frameshift shift in the reading frame changes everything downstream insertions adding base(s) deletions losing base(s)

52 AP Biology What s the value of mutations?

53 AP Biology Chapter 17. RNA Processing

54 AP Biology Transcription -- another look The process of transcription includes many points of control when to start reading DNA where to start reading DNA where to stop reading DNA editing the mRNA protecting mRNA as it travels through cell

55 AP Biology Primary transcript Processing mRNA protecting RNA from RNase in cytoplasm add 5 cap add polyA tail remove introns AUGUGA

56 AP Biology Protecting RNA 5 cap added G trinucleoside (G-P-P-P) protects mRNA from RNase (hydrolytic enzymes) 3 poly-A tail added As protects mRNA from RNase (hydrolytic enzymes) helps export of RNA from nucleus UTR

57 AP Biology Dicing & splicing mRNA Pre-mRNA mRNA edit out introns intervening sequences splice together exons expressed sequences In higher eukaryotes 90% or more of gene can be intron no one knows why…yet theres a Nobel prize waiting… AVERAGE … gene = 8000b pre-mRNA = 8000b mature mRNA = 1200b protein = 400aa lotsa JUNK !

58 AP Biology Discovery of Split genes 1977 | 1993 Richard RobertsPhilip Sharp NE BioLabsMIT adenovirus common cold

59 AP Biology snRNPs small nuclear RNA RNA + proteins Spliceosome several snRNPs recognize splice site sequence cut & paste RNA as ribozyme some mRNA can splice itself RNA as enzyme Splicing enzymes

60 AP Biology Ribozyme RNA as enzyme Sidney AltmanThomas Cech 1982 | 1989 YaleU of Colorado

61 AP Biology Splicing details No room for mistakes! editing & splicing must be exactly accurate a single base added or lost throws off the reading frame AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|

62 AP Biology Alternative splicing Alternative mRNAs produced from same gene when is an intron not an intron… different segments treated as exons Hard to define a gene!

63 AP Biology Domains Modular architecture of many proteins separate functional & structural regions coded by different exons in same gene

64 AP Biology AAAAAAAAGTP 20-30b 3' promoter transcription stop transcription start introns The Transcriptional unit (gene?) transcriptional unit TACACT DNA TATA 5' RNA polymerase pre-mRNA 5'3' translation start translation stop mature mRNA 5'3' UTR exons enhancer b

65 AP Biology Any Questions??

66 AP Biology b 3' introns The Transcriptional unit transcriptional unit TACACT DNATATA 5' RNA polymerase 5'3' 5'3' exons enhancer b

Download ppt "AP Biology 2005-2006 Chapter 17. From Gene to Protein."

Similar presentations

Ads by Google