Presentation is loading. Please wait.

Presentation is loading. Please wait.

Speciation Discussion How does a new species arise?

Similar presentations

Presentation on theme: "Speciation Discussion How does a new species arise?"— Presentation transcript:


2 Speciation

3 Discussion How does a new species arise?

4 First…what is a species? Biological species concept population whose members can interbreed & produce viable, fertile offspring reproductively compatible Western MeadowlarkEastern Meadowlark Distinct species: songs & behaviors are different enough to prevent interbreeding

5 But that doesnt capture every situation Consider Ensatina salamanders. How many species? Which ones are different species?

6 Species Definitions Other definitions include: Morphological or typological - They conform to the same body plan. Phylogenetic or evolutionary - Share a common ancestor and a unique evolutionary history. Ecological - Share a specific niche, unique to them and them alone. Species is a human language box. Never forget that nature exists on a continuum!

7 Discussion Which definitions work or dont work to determine whether or not youre examining different species if youre studying… Bacteria in a lab petri dish? Hooved mammals in the modern-day arctic? Dinosaurs? Ancient algae?

8 How and why do new species originate? Species are created by a series of evolutionary processes populations become isolated - no gene flow between them geographically isolated and/or reproductively isolated isolated populations evolve independently Isolation allopatric geographic separation sympatric still live in same area

9 An obstacle to mating or fertilization PRE-zygotic barriers behavioral isolation geographic isolation ecological isolation temporal isolation mechanical isolation gametic isolation

10 Geographic isolation Species occur in different areas physical barrier allopatric speciation other country Harriss antelope squirrel inhabits the canyons south rim (L). Just a few miles away on the north rim (R) lives the closely related white-tailed antelope squirrel Ammospermophilus spp

11 Ecological isolation Species occur in same region, but occupy different habitats so rarely encounter each other reproductively isolated 2 species of garter snake, Thamnophis, occur in same area, but one lives in water & other is terrestrial lions & tigers could hybridize, but they live in different habitats: lions in grasslands tigers in rainforest lions & tigers could hybridize, but they live in different habitats: lions in grasslands tigers in rainforest

12 Temporal isolation Species that breed during different times of day, different seasons, or different years cannot mix gametes reproductive isolation sympatric speciation same country Eastern spotted skunk (L) & western spotted skunk (R) overlap in range but eastern mates in late winter & western mates in late summer

13 Behavioral isolation Unique behavioral patterns & rituals isolate species identifies members of species attract mates of same species courtship rituals, mating calls reproductive isolation Blue footed boobies mate only after a courtship display unique to their species sympatric speciation?

14 firefly courtship displays courtship display of Gray-Crowned Cranes, Kenya courtship songs of sympatric species of lacewings Recognizing your own species

15 Mechanical isolation Morphological differences can prevent successful mating reproductive isolation Even in closely related species of plants, the flowers often have distinct appearances that attract different pollinators. These 2 species of monkey flower differ greatly in shape & color, therefore cross-pollination does not happen. Plants sympatric speciation?

16 Mechanical isolation For many insects, male & female sex organs of closely related species do not fit together, preventing sperm transfer lack of fit between sexual organs: hard to imagine for us… but a big issue for insects with different shaped genitals! Damsel fly penises Animals

17 Gametic isolation Sperm of one species may not be able to fertilize eggs of another species mechanisms biochemical barrier so sperm cannot penetrate egg receptor recognition: lock & key between egg & sperm chemical incompatibility sperm cannot survive in female reproductive tract Sea urchins release sperm & eggs into surrounding waters where they fuse & form zygotes. Gametes of different species red & purple are unable to fuse. sympatric speciation?

18 POST-zygotic barriers Prevent hybrid offspring from developing into a viable, fertile adult reduced hybrid viability reduced hybrid fertility hybrid breakdown zebroid

19 Reduced hybrid viability Genes of different parent species may interact & impair the hybrids development Species of salamander genus, Ensatina, may interbreed, but most hybrids do not complete development & those that do are frail. sympatric speciation?

20 Mules are vigorous, but sterile Reduced hybrid fertility Even if hybrids are vigorous they may be sterile chromosomes of parents may differ in number or structure & meiosis in hybrids may fail to produce normal gametes Donkeys have 62 chromosomes (31 pairs) Horses have 64 chromosomes (32 pairs) Mules have 63 chromosomes!

21 Hybrid breakdown Hybrids may be fertile & viable in first generation, but when they mate offspring are feeble or sterile In strains of cultivated rice, hybrids are vigorous but plants in next generation are small & sterile. On path to separate species. In strains of cultivated rice, hybrids are vigorous but plants in next generation are small & sterile. On path to separate species. sympatric speciation?

22 Niles Eldredge Curator American Museum of Natural History Rate of Speciation When considering speciation events over geological time: Does speciation happen gradually or rapidly, uniformly or unevenly? Gradualism Charles Darwin Charles Lyell Punctuated equilibrium Stephen Jay Gould Niles Eldredge

23 Gradualism Gradual, constant divergence over long spans of time big changes occur as the accumulation of many small ones events can increase or decrease speciations worldwide, but overall speciation proceeds fairly regularly

24 Punctuated Equilibrium Rate of speciation is not constant Organisms are in stasis for much of their history, with little or no change When speciation occurs, it tends to be in a rapid burst Species undergo rapid change when they 1 st bud from parent population Time

25 Discussion Based upon what you know of evolutionary history, where do you fall: gradualism or punctuated equilibrium supporter?

26 Speciation Rates Regardless of whether punctuated equilibrium or gradualism holds, speciation rates vary by species and circumstance Speciation can occur over a scale of millions of years, or much more rapidly! Polyploidy in plants increases speciation rate to, in some cases, only a few years

27 Polyploidy and Hybrid Speciation Unlike in animals, in plants, duplicating the genome (polyploidy) isnt fatal. Plants hybridize more often and more readily than animals on average Sometimes in plants, a diploid hybrid is sterile, but a triploid or tetraploid hybrid isnt due to the mechanisms of chromosome alignment in their haploid life phase.

28 Polyploidy and Hybrid Speciation Polyploid offspring may reproduce with other polyploids, or re-reproduce with a parental type, or may self-fertilize (oh plants, you so crazy) But by any of the three mechanisms, polyploids wind up reproductively isolated from the parental population, but produce non-sterile offspring = theyre a new population that evolution will be acting upon! A new species, in as little as a generation!

29 Polyploidy and Hybrid Speciation This has been observed in species like the Evening Primrose, Raphanobrassica, Hemp Nettle, and the Maidenhair Fern.

30 Speciation Rates In all species, when a new habitat or new niche becomes available, speciation rates tend to increase Adaptive radiation - ecological & phenotypic diversity in a rapidly multiplying lineage

31 Discussion Scientists generally break it down into two main reasons why this causes a burst in speciation events. What do you think they could be?

32 Speciation Rates Ex: Darwins finches Ex: An explosion in bivalve species diversity after the loss of brachiopods in the Great Dying, or Permian extinction 250 mya

33 Extinction But, of course, extinction rates also fluctuate Higher in times of environmental stress Million years ago % of families extinct

34 Discussion A populations ability to respond to environmental changes is dictated, in part, by its level of genetic diversity. Which do you think is most resistant to extinction and why: high-genetic- diversity or low-genetic-diversity?

35 Lines of Evidence Morphological, Molecular, and Other

36 Lines of Evidence Modes of investigation into evolutionary history include Morphological Molecular Developmental (which is part Morphology, part Molecular Biology) Geographical* Geological* Active change * - Not addressed in notes - read up on basic definition of biogeography, fossil record at home

37 Discussion What is the relationship between: Recency of two populations last common ancestor Amount of similarity between populations Degree of relatedness between populations …and WHY?

38 Morphological Evidence Morphology = body form Shared deep body structures are evidence of shared ancestry, but appearances and functions arent necessarily… why not?

39 Anatomical record Homologous structures similarities in characteristics resulting from common ancestry

40 Homologous structures Similar structure Similar development Different functions Evidence of evolutionary relationship

41 spines tendrils succulent leaves colored leaves Homologous structures leaves needles

42 Homologous Structures Produced by divergent evolution Your typical population divided, evolves in two separate directions scenario Structure present in ancestor passed down to descendents

43 Analogous structures Separate evolution of structures similar functions similar external form different internal structure & development different origin no evolutionary relationship Solving a similar problem with a similar solution

44 Analogous Structures Flight evolved in 3 separate animal groups evolved similar solution to similar problems

45 Analogous Structures Fish: aquatic vertebrates Dolphins: aquatic mammals similar adaptations to life in the sea not closely related Those fins & tails & sleek bodies are analogous structures!

46 Analogous Structures Analogous structures produced by convergent evolution or parallel evolution Convergent evolution: Two separate, asynchronous (different times, different ecospaces) evolutionary lineages develop a similar trait/solution Example: pillbugs and pillmillipedes both develop similar defenses, but didnt inherit them from a so-defended shared ancestor

47 Parallel Evolution Like convergent evolution, but the two species evolve at the same time and/or in the same ecospace filling similar ecological roles in similar environments, so similar adaptations were selected marsupial mammals marsupial mammals placental mammals placental mammals

48 Parallel types across continents NichePlacental MammalsAustralian Marsupials Burrower Mole Anteater Mouse Lemur Flying squirrel Ocelot Wolf Tasmanian wolf Tasmanian cat Sugar glider Spotted cuscus Numbat Marsupial mole Marsupial mouse Anteater Nocturnal insectivore Climber Glider Stalking predator Chasing predator

49 Vestigial structures Modern structures that have reduced or no function remnants of structures that were functional in ancestral species deleterious mutations accumulate in genes for non-critical structures without reducing fitness eyes on blind cave fish are a kind of homology

50 Vestigial organs Hind leg bones on whale fossils and modern whales Why would whales have pelvis & leg bones if they were always sea creatures?

51 Vestigial structures Spurs or tiny leg bones in snakes

52 Vestigial structures Arrector pili, post-caudal tail, appendix in humans

53 Molecular Evidence Evidence from genes & proteins The most powerful and commonly-used these days, in part because the data set is so vast and in part because its easily quantifiable

54 Conservation What does it mean to say a homologous sequence or structure is highly conserved? Means its extremely similar or identical amongst the organisms that inherited it Conserved sequences = useful evidence in uncovering ancestry

55 Conserved Structures Example, metabolic pathways = highly conserved across all domains of life (archaea, bacteria, eukarya) A remnant of lifes common ancestry Bacterial metabolic enzymes - notice, more of them are common to all 3 domains than are at all unique

56 Conserved Structures Example: Structural evidence supports the relatedness of all eukaryotes More than just the nucleus is conserved… linear chromosomes, membrane-bound organelles, and endomembrane systems are as well

57 Molecular record Molecular evidence elegantly demonstrates the relatedness of all life universal genetic code! The ultimate conserved sequence - the whole darned thing! DNA, RNA, proteins - genome, transcriptome, proteome Closely related species have sequences that are more similar than distantly related species DNA & proteins are a molecular record of evolutionary relationships Closely related species have sequences that are more similar than distantly related species DNA & proteins are a molecular record of evolutionary relationships

58 Discussion The more similar genetic loci two populations share, the more related they are WHY would this be??

59 Conserved Sequences Think of a conserved sequence (which can be as little as a single base pair) as being a genetic homologous structure

60 Conserved Sequences Suppose an ancestral population has the sequence AAGTCTTTAGCTAGCTGGCTGT at a particular locus. Over time, it accumulates mutations. Demo!


62 Discussion Suppose you have this information for locus ß135 in three similar species. Species A: AGCTTCGATTGCTAGCTA Species B: AGCTACGATTGGTAGCTA Species C: AGCTACGACCTTGGTAGCTA Whos most related? Who shares the most recent LCA?

63 It works for proteins, too! Number of amino acid differences between hemoglobin (146 aa) of vertebrate species and that of humans Number of amino acid differences between hemoglobin (146 aa) of vertebrate species and that of humans LampreyFrogBird Dog MacaqueHuman Why does comparing amino acid sequence measure evolutionary relationships?

64 Molecular Evidence An organisms evolutionary history is documented in its genome! How many similarities are shared between populations? DNA hybridization experiments Track SNPs (single nucleotide polymorphisms), conserved sequences, common loci, duplicated genes Analyze pseudogenes (vestigial genes) Even analyze whole genomes…

65 Genome sequencing What can data from whole genome sequencing tell us about evolution of humans?

66 Primate Common Ancestry Chromosome Number in the Great Apes (Hominidae) orangutan (Pogo)48 gorilla (Gorilla)48 chimpanzee (Pan)48 46 human (Homo)46 Chromosome Number in the Great Apes (Hominidae) orangutan (Pogo)48 gorilla (Gorilla)48 chimpanzee (Pan)48 46 human (Homo)46 Hypothesis: Change in chromosome number? If these organisms share a common ancestor, then is there evidence in the genome for this change in chromosome number Hypothesis: Change in chromosome number? If these organisms share a common ancestor, then is there evidence in the genome for this change in chromosome number Could we have just lost a pair of chromosomes?

67 Chromosomal fusion Testable prediction: Testable prediction: If common ancestor had 48 chromosomes (24 pairs), then humans carry a fused chromosome (23 pairs). Centromere Telomere Ancestral Chromosomes FusionHomo sapiens Inactivated centromere Telomere sequences Chromosome Number in the Great Apes (Hominidae) orangutan (Pogo)48 gorilla (Gorilla)48 chimpanzee (Pan)48 46 human (Homo)46 Chromosome Number in the Great Apes (Hominidae) orangutan (Pogo)48 gorilla (Gorilla)48 chimpanzee (Pan)48 46 human (Homo)46

68 Test of the Human Genome Chromosome 2 is unique to the human lineage of evolution, having emerged as a result of head-to-head fusion of two chromosomes that remained separate in other primates. The precise fusion site has been located in 2q13–2q14.1, where our analysis confirmed the presence of multiple subtelomeric duplications to chromosomes 1, 5, 8, 9, 10, 12, 19, 21 and 22. During the formation of human chromosome 2, one of the two centromeres became inactivated (2q21, which corresponds to the centromere from chimp chromosome 13) and the centromeric structure quickly deterioriated. Hillier et al (2005) Generation and Annotation of the DNA sequences of human chromosomes 2 and 4, Nature 434: 724 – 731. Chr 2 Ancestral Chromosomes FusionHomo sapiens Inactivated centromere Telomere sequences Human Chromosome #2 shows the exact point at which this fusion took place

69 Discussion If you want to analyze the evolutionary history of an order, a phylum, a kingdom, etc., what kinds of genes do you think would be most productive to study?

70 Molecular Clocks Some genes show a constant rate of mutation/evolution They can be used as molecular clocks and used to calculate the time since divergence, calibrated against branches whose dates are known from the fossil record Divergence time (millions of years) Number of mutations

71 Molecular Clocks Example: Use of molecular clocks demonstrates that HIV leapt from simians to humans in the 1930s

72 Year HIV Range Adjusted best-fit line (accounts for uncertain dates of HIV sequences) Index of base changes between HIV gene sequences

73 Evo-Devo: Morpho+DNA Evidence Comparative embryology reveals anatomical similarity not visible in adults Ex: all vertebrate embryos have similar structures at similar stages of development gill pouch in fish, frog, snake, birds, human, etc. Pharyngeal pouches Post-anal tail Human embryo Chick embryo (LM)

74 Evo-Devo Major changes in body form can result from changes in the sequences and regulation of developmental genes Genes that program development control the rate, timing, and spatial pattern of changes in an organisms form as it develops Ex: A change in the rate of gene expression produces very different skulls from the same genes Chimpanzee fetus -> adult Human fetus -> adult

75 Evo-Devo Ex: A change in spatial expression of the Hox gene produces body parts in a new location, without a change in coding genes Hox gene 6Hox gene 7 Hox gene 8 About 400 mya Drosophila Artemia Repeated Hox expression extends body

76 Evo-Devo Among MANY other evolutionary applications, these means that modern organisms have many ancient genes still in place that can be used to study the ancestral form Those genes are just producing different phenotypes now because of changes to regulatory sequences

77 Active Change Examples of ongoing change Artificial selection Antibiotic resistance Industrial melanism

78 Artificial selection A rtificial breeding can use variations in populations to create vastly different breeds & varieties descendants of the wolf descendants of wild mustard

79 Selective breeding the raw genetic material (variation) is hidden there

80 Selective breeding Hidden variation can be exposed through selection!

81 Antibiotic Resistance

82 Industrial Melanism Classic Peppered Moth study: Dark vs. light variants Year% dark% light

83 Tree Thinking Phylogenetics, Cladistics, Systematics

84 Tree Thinking Phylogeny is the evolutionary history of a species or group of related species Systematics uses fossil, molecular, and morphological data to infer evolutionary relationships and classify organisms Depict these relationships in branching cladograms or phylogenetic trees

85 Order Family Panthera pardus (leopard) Genus Species Canis latrans (coyote) Taxidea taxus (American badger) Lutra lutra (European otter) Canis lupus (gray wolf) Felidae Carnivora Panthera Taxidea Mustelidae Lutra Canidae Canis

86 Phylogenetic Trees A phylogenetic tree is a hypothesis about evolutionary relationships Moves forward in time from the root Each branch point represents a shared common ancestor (usually not labeled) Sister taxa represented by the tips of the branches

87 Branch point: where lineages diverge ANCESTRAL LINEAGE This branch point represents the common ancestor of taxa A–G. This branch point forms an unresolved pattern of divergence, shared by taxa D, E, and F. Sister taxa Taxon A Taxon B Taxon C Taxon D Taxon E Taxon F Taxon G

88 Lizards and snakes Crocodilians Ornithischian dinosaurs Saurischian dinosaurs Birds Common ancestor of crocodilians, dinosaurs, and birds Discussion – Who is most related? Wheres the LCA?

89 Phylogenetic Trees - Limitations & Rules Show patterns of descent, not phenotypic similarity. Dont necessarily indicate how long ago species diverged, or how much its changed since then. Taxa DID NOT evolve from any sister taxa!

90 Cladistics Trees are constructed based on homologies, physical or molecular Cladistics groups organisms by common descent. A clade = a group of species that includes an ancestral species and its descendents To be valid, a clade must be monophyletic - include all descendent species, and no non-descendents

91 (a) Monophyletic group (clade) Group A B C D E F G

92 Cladistics Invalid clades are Paraphyletic – Includes the ancestor but not all of its descendents Polyphyletic - Includes some species that do not share the ancestor in question

93 (a) Monophyletic group (clade) (b) Paraphyletic group (c) Polyphyletic group Group A B C D E F G A B C D E F G A B C D E F G

94 Valid Clades Are reptiles monophyletic, paraphyletic, or polyphyletic? Should reptile be a valid classification?

95 Cladistics When comparing it to its ancestor, a species/clade displays various homologies. Shared ancestral characters - originated in an ancestor, shared with all members. Shared derived characters - An inherited novelty unique to that clade.

96 Cladistics Can use either morphological or molecular homologies Generally, a chart with + or 1 for has it, 0 or - for doesnt To construct a tree, examine shared and derived characters, and follow the principle of parsimony, also called Occams Razor: the simplest explanation is usually the best.

97 TAXA Vertebral column (backbone) Four walking legs Hinged jaws Amnion Hair (a) Character table CHARACTERS Lancelet (outgroup) Lamprey Bass Frog Turtle Leopard Discussion – Practice!

98 Variations Cladograms can be constructed to show time or distance since divergence, amount of difference… Trees can take different shapes: angled splits, square splits, circular…

99 Branch lengths indicate time Mouse Human Chicken Frog Zebrafish Lancelet Drosophila Present CENOZOIC MESOZOIC PALEOZOIC Millions of years ago

100 Tree Shapes

Download ppt "Speciation Discussion How does a new species arise?"

Similar presentations

Ads by Google