Presentation is loading. Please wait.

Presentation is loading. Please wait.

RNA PROCESSING DNA MATURE RNA PROTEIN PRECURSOR RNAs pre-rRNA pre-tRNA pre-mRNA Cleavage Nucleotide addition Nucleotide insertion Nucleotide removal Sequence.

Similar presentations


Presentation on theme: "RNA PROCESSING DNA MATURE RNA PROTEIN PRECURSOR RNAs pre-rRNA pre-tRNA pre-mRNA Cleavage Nucleotide addition Nucleotide insertion Nucleotide removal Sequence."— Presentation transcript:

1 RNA PROCESSING DNA MATURE RNA PROTEIN PRECURSOR RNAs pre-rRNA pre-tRNA pre-mRNA Cleavage Nucleotide addition Nucleotide insertion Nucleotide removal Sequence addition Sequence removal Base modification Sugar modification Other RNA-related factors affecting expression abundance (combination of transcription and degradation) localization recruitment to ribosomes

2 RNAs THAT FUNCTION IN RNA PROCESSING rRNA snoRNAsform complexes with protein, direct nt modifications snoRNAs also modify tRNAs, and likely other RNAs tRNA RNase P has both RNA and protein components mRNA snRNPsU1,2,4,5,6 form spliceosomes with many proteins gRNAsprovide sequence information for RNA editing miRNAsimportant for regulating gene expression siRNAsimportant for regulating gene expression

3 RNAs THAT FUNCTION IN RNA PROCESSING RNA functions in RNA processing based on complementary basepairing to direct site of action action is usually catalyzed by protein some RNAsribozymes are have catalytic activity self-splicing intron in Tetrahymena rRNA hammerhead ribozymes are self-cleaving another RNA with catalytic function is LSU rRNA Telomerase RNA for telomere replication RNA primer for mitochondrial replication

4 PROCESSING OF rRNAs Cleavage:Pre-rRNA is cleaved to 18S, 5.8S, 28S rRNAs; cleavage order is precise (within species). Modification:Bases and sugars are modified prior to assembly into ribosomes. 5S rRNA encoded separately, elsewhere in genome ETS ITS1 ITS2 ETS 18S 5.8S 28S ETS ITS1 ITS2 ETS 18S 5.8S 28S ETS ITS1 ITS2 ETS 18S 5.8S 28S ETS ITS1 ITS2 ETS 18S 5.8S 28S ETS ITS1 ITS2 ETS 18S 5.8S 28S Schematic is generic and not to scale;

5 rRNA PROCESSING IN NUCLEOLUS Modifications of nucleotides: rRNAs ~100 riboses are 2O-methylated 10 bases methylated 95 Us isomerized to pseudoUs (ψs) tRNAs ~100 kinds of modified nucleotides some incorporated during transcription some chemically modified post-transcription

6 RNA MODIFICATION snoRNAs modify rRNAs, tRNAs, miRNAs, siRNAs, and mRNAs C/D snoRNAs direct methylation H/ACA snoRNAs direct pseudouridylation number of snoRNAs variable between organisms; more being found size range ~60 to ~300 nt encoded individually, in polycistronic clusters, or in introns. Most C/D snoRNAs have 5 trimethylguanosine (TMG) cap. So do snRNAs. Patients with motor neuron degeneration diseases often develop antibodies that recognize TMG caps.

7 SnoRNA interactions with RNA C/D snoRNAs direct methylation H/ACA snoRNAs direct pseudouridylation snoRNAs can interact with and modify either one or two sites.

8 PROCESSING OF tRNAs All tRNAs undergo: Cleavage to form 5 and 3 ends Nucleotide modification 3 CCA addition Some tRNAs undergo: Intron excision RNA editing Following processing, tRNAs are charged by amino acyl transferases before trafficking to cytoplasm. anticodon 5 leader 3 trailer intron CCA addition

9 tRNA PROCESSING Removal of 5 leader and 3 trailer; order not absolute CCA may be encoded (prok.) or added post-transcriptionally (euk.) Acceptor stem sometimes edited Some tRNAs have introns in the anticodon loop Many nucleotide modifications editing intron

10 PROCESSING OF mRNAs Capping Polyadenylation Splicing Editing

11 mRNA processing - capping 5 capping required for translation of eukaryotic mRNAs mediates initial ribosome binding 7-methylguanosine cap added as RNA exits RNApol II. G linked via a 5-5 pyrophosphate bridge to first nt of mRNA G methylated post-addition first bases in mRNA may be methylated

12 mRNA processing From birth to death, an mRNA associates with a variety of proteins and other RNAs that modify it directly or affect its abundance and recruitment to ribosomes. mRNP (messenger ribonucleoprotein particle) – mRNA + associated proteins.

13 RNA processing - splicing Removes blocks of non-coding sequence (introns), ligates the surrounding coding sequences (exons). Catalyzed by an RNA/protein complex, the spliceosome, which is composed of 5 small nuclear RNAs (snRNAs) designated U1, U2, U4, U5, and U6 plus 50+ proteins Occurs by two transesterification reactions (no energy) 1. Branch point 2OH attacks 5 splice junction 2. 3OH of 5 fragment attacks 3 splice site, forming a phosphodiester bond The intron is released as a lariat in cis-splicing or a Y intermediate in trans-splicing.

14 2OH attack cis-SPLICING 3OH attack Pre-mRNA 5 exon 3 exon GU A YAG

15 1 st TE 2 nd TE Splicing snRNPs

16 RNA SPLICING U1 RNA (snRNP) forms helix with 5 splice site U2 RNA (snRNP) forms helix with branch point U4, U5, U6 RNA (snRNP) forms helix with 5 splice site, displacing U1 forms helix with U2, with loss of U4 First step of splicing occurs Rearrangement occurs Second step of splicing occurs

17 trans-SPLICING cis-splicing: both exons on same RNA trans-splicing: exons on different RNAs trans-splicing first identified in trypanosomatids adds first bases of 5 UTR (spliced leader) including 5 cap ALL tryp mRNAs encoded by nucleus are trans-spliced some helminth mRNAs are trans-spliced, not all adds 5 end sequences a few cases of trans-splicing reported in mammals catalyzed by a spliceosome occurs by successive transesterifications.

18 trans-SPLICING Y intermediate Y intron 2OH attack 3OH attack

19 RNA splicing – mechanisms for diversity Alternate splicing Alternate promoters Alternate polyadenylation sites Once considered the exception, it now appears that generating more than one mRNA per gene is a common mechanism for increasing diversity without the expense of maintaining additional genes. Based on ESTs, at least 50% of human genes may produce alternatively spliced mRNAs. Drosophila Dscam gene theoretically has 38,016 possible mRNAs!

20 RNA PROCESSING - EJC Exon junction complex (EJC) core set of proteins and a changing cast of other proteins impacts mRNA splicing, export, localization, translation, and turnover associates with mRNA nt upstream of exon-exon junctions. binding to mRNA is position- dependent, not sequence dependent. effect is location-dependent. EJC in ORF enhances translation. EJC in 3 UTR enhances turnover. stays associated with mRNA until translation begins.

21 RNA 3 end formation Details for transcription termination and 3 end cleavage are debated. 3 ends of (almost all) eukaryotic mRNAs are generated by cleavage. Same or similar endonuclease used for 3 end of mRNAs and of snRNAs. Poly(A) tail is added following 3 end formation and mRNP is exported to the cytoplasm.

22 RNA export mRNP export from nucleus: association with adaptors exit through NPC

23 RNA utilization Localization within cell Storage until needed Recruitment to ribosomes RNA turnover Proteins destined to be associated may be translated on co- localized polysomes. PABP binds eIF-4E, eIF-4G, circularizing polysomes and increases efficiency of protein synthesis.

24 mRNA localization a) DAPI stained S. cerevisiae; b) ASH1 mRNA in same cells; c) hairy (green) and even-skipped (red) mRNAs in Drosophila embryo; d) vasa mRNA localizing to division planes in zebrafish embryo, red is β-catenin; e) dpp mRNA (red) at centrosomes in 8 cell embryo. Blue is DAPI, green microtubules; f) β-actin in cultured neurons (red), green is tau, an axonal marker.

25 RNA utilization Localization within cell Storage until needed Recruitment to ribosomes RNA turnover Translational control

26 RNA turnover Steady state abundance of any molecule reflects the balance between its rate of synthesis and degradation. Finetuning cell functions thus requires not only transcription but mRNA turnover. Recently siRNAs and miRNAs have been identified as exerting considerable effect on RNA degradation and translational blocking, respectively. In addition, the poly(A) tail is an important feature. mRNAs with long poly(A) tails are preferentially translated mRNAs with short or absent poly(A) tails are stored or degraded.

27 RNA turnover a)Deadenylation followed by decapping and degradation from 5 end. Alternatively, deadenylation is followed by degradation from 3 end to the cap, followed by cap degradation. b)Proteins that recognize prematurely terminated translation trigger both deadenylation and decapping c)Recruitment of proteins to AU-rich elements triggers both deadenylation and decapping.

28 RNA turnover RNA turnover is localized to discrete foci in the cytoplasm called processing bodies or P bodies. Enzymes are partially degraded mRNAs have been co-localized to P bodies P bodies in HeLa cell visualized using anti-hDCP1a. Nucleus stained with DAPI.

29 siRNA, miRNA siRNA: small interfering RNA miRNA: microRNA Both are processed to nt RNAs which associate with proteins in a RISC complex (RNA-induced silencing complex). Key roles in regulating gene expression in many eukaryotes but not universal.

30 RNA editing changes the sequence of an RNA from that encoded by DNA, producing a functional transcript. First considered a bizarre relic; now recognized as widespread RNA editing has been reported in: protozoa, plants and mammals, not yet fungi or prokaryotes nuclear, mitochondrial, chloroplast, and viral RNAs mRNA, tRNA, rRNA Two general types Base modification (deaminase) A to I double-stranded mechanism, seen in viruses, human genes C to U, U to C seen in chloroplasts, plant mitochondria, human genes Insertion/deletion U insertion/deletion, seen in kinetoplastid protozoa mono/di nucleotide insertion, seen in Physarum nucleotide replacement, seen in Acanthamoeba tRNAs RNA editing

31 AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAU UGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAA AGGGAAAGUUGUGAUUUUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA M K E K G F E R G V F W G E E K E F W I W T I C L S Y G R E A R R R K V G E F W G D S W G E A G G R R R F W K H P F L G G ter E G R K G E M E L G I A F A K L L E E R A G K V R G R R E E R E S C D F G V I E ter D Q I S terter pre-edited AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAU UGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAA AGGGAAAGUUGUGA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAU UGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAA AGGGAAAGUUGuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAU UGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAA AGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUA AUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAU UGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGuuuAGuuuuGuA uuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGU UAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAU UGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGG**AuuuuuuGuuGuuuuuGu uGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG* *GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAuUUGuuGG AuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGC AGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuu uuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAU AAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGuuuAuuAuuuuAUGuG uuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuu uGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuA GuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA* *UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuA uuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUU uGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAu AAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAG uuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCA AAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuu GuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuu uuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuG uAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGu uuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**U UGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGA GuGuuuuuCuuuGuuGuGuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuA uuAuCAuCCCAuUUUUUAuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuu uuuuuuuuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuu GuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC* ***AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuG uuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGA AAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAuAuuGCAuuuuuA uuuuuGuuuuGuuuuuuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA ****GuuuuAuGGAuGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuu uuCuuuGuuGuGuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCA uCCCAuUUUUUAuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuu uuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAu uAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGu uAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuG uuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG **GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACuUAUUUG***AAuuuG*UAuuUGuuGuuuuGuAuuGu uuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGuuuuGuuuuuuAuGuGAuuuuuuuuuG uuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAuGGAuGuuuuuuuuAUUC**Guu uuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGuGuCGuuGuuuGuCGACGuuuuu GCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUUAuuGuuGAuGuuuuuuGAuuuu uuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuu AuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAU UuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGA uAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuA GuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUC AAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGuuGuGGu uuAuGuuGuuuAAuuuAuAuAGuuuAAUUUUGuAuuA*UUGuAuuACuUAUUUG***A AuuuG*UAuuUGuuGuuuuGuAuuGuuuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGu uuuGuuuuuuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****Guu uuAuGGAuGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuG uuGuGuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuU UUUUAuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGG uuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuA UGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAu uuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuG uuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUG uuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAuuuuAAuUGuuuAAuGuuGAuuuuuGAuuuuuuAuuAuuuuGuuu G*UUUGAuuuGuAuuuGuuuGuuGGuuuGuG***UUUGuuuuuAuuGuuGuGGuuuAu GuuGuuuAAuuuAuAuAGuuuAAUUUUGuAuuA*UUGuAuuACuUAUUUG***AAuuu G*UAuuUGuuGuuuuGuAuuGuuuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGuuuuG uuuuuuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAu GGAuGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGu GuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUU AuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuu uuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuG uuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuu uGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuA GuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA* *UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGuuuuuAuuuuuuuuuuGuGAuuuA UUUUGGuuGCGuuuGuuAuuAuGuAuGuAuuAuuGuGuAuGAuCuAGGuuAuGuuuuA uuGuGuAuuuuAAuUGuuuAAuGuuGAuuuuuGAuuuuuuAuuAuuuuGuuuG*UUUG AuuuGuAuuuGuuuGuuGGuuuGuG***UUUGuuuuuAuuGuuGuGGuuuAuGuuGuu uAAuuuAuAuAGuuuAAUUUUGuAuuA*UUGuAuuACuUAUUUG***AAuuuG*UAuu UGuuGuuuuGuAuuGuuuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGuuuuGuuuuuu AuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAuGGAuGu uuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGuGuCGuu GuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUUAuuGuu GAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGuuA uuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuA uAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAu AuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuG uAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGA GUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAuAuGuuuuuAuuuuuuuuuuGuGAuu uAUUUUGGuuGCGuuuGuuAuuAuGuAuGuAuuAuuGuGuAuGAuCuAGGuuAuGuuu uAuuGuGuAuuuuAAuUGuuuAAuGuuGAuuuuuGAuuuuuuAuuAuuuuGuuuG*UU UGAuuuGuAuuuGuuuGuuGGuuuGuG***UUUGuuuuuAuuGuuGuGGuuuAuGuuG uuuAAuuuAuAuAGuuuAAUUUUGuAuuA*UUGuAuuACuUAUUUG***AAuuuG*UA uuUGuuGuuuuGuAuuGuuuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGuuuuGuuuu uuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAuGGAu GuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGuGuCG uuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUUAuuG uuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGu uAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuu uAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuA AuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuu uGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUG GAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA editing in progress... edited M F L F F F C D L F W L R L L L C M Y Y C V W S R L C F I V Y F N C L M L I F D F L L F C L F D L Y L F V G L C L F L L L W F M L F N L Y S L I L Y Y C I T Y L N L Y L L F C I V F L L Y I A F L F L F C F L C D F F L F N N L L V G D S F M D V F F I R F L L C F L E C F S L L C R C L S T F L R L F C N L L S S H F L L L M F F D F F Y F I F V F F F W C F L L L I Y F I Y F C V L F L F I I L C V F I F V G F I C R H I T V I Y F L ter Bhat et al. (1990) edited T. brucei ATPase subunit 6 RNA

32 ||||||||||||||...AAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGUGAUUUUGGAGUUAUAG... |·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAU AGCCUCAAUAUC......AAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGUGAUUGGAGUUAUAG... ||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAA UAGCCUCAAUAUC......AAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGUGuuAUUGGAGUUAUAG... ·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAA GCAAUAGCCUCAAUAUC......AGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGuuUGuuAUUGGAGUUAUAG... ·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGAC UAAGCAAUAGCCUCAAUAUC......AAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGGuuUGuuAUUGGAGUUAUAG... |·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGA CUAAGCAAUAGCCUCAAUAUC......GAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAuuuGGuuUGuuAUUGGAGUUAUAG... ·||||·||·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGACAG UUUUAGACUAAGCAAUAGCCUCAAUAUC......GCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG... ||··||||·||·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGA CAGUUUUAGACUAAGCAAUAGCCUCAAUAUC......AGGAAAGGUUAGGGGGAGGAGAGAAGAAAGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG... ··|||··||||·||·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAG UGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC......GAAAGGUUAGGGGGAGGAGAGAAGAAAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG... ||···|||··||||·||·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUA UAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC......AAAGGUUAGGGGGAGGAGAGAAGAAuAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG... ||||···|||··||||·||·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAG UAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC......AGGUUAGGGGGAGGAGAGAAGAuuAuAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG... ||·||||···|||··||||·||·||·|||||·|||||||||| UUUUUUUUUUUUAUUAA UAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC......GUUAGGGGGAGGAGAGAAGuuAuuAuAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG... |·||||·||||···|||··||||·||·||·|||||·|||||||||| UUUUUUUUUUUUA UUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC UUAGGGGGAGGAGAGAuAGuuAuuAuAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG...3 ····|··|·|·|||·||||·||||···|||··||||·||·||·|||||·|||||||||| 3 UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC...5 Anchor Information U tail directed by guide RNAs (gRNAs) nt RNAs with post-transcriptionally added oligo(U) tails Edited region specified by a single gRNA = block Editing starts at the 3 end of the pre-edited mRNA. Editing directed by the first gRNA creates the mRNA sequence which will be recognized by the next gRNA. This creates an overall 3 to 5 direction for editing. 3 Block 1 Block 2 UUUUU Block 3 5 ||||||| RNA editing in kinetoplastid mitochondria gRNA mRNA

33 RNA editing in kinetoplastid mitochondria ND8 ND9 ND7 COII MURF2 CR4 CR5 RPS12 A6 CYB COIII CR3 22kb MAXICIRCLE (~50 copies) gRNA 1 gRNA 2 gRNA 3 ~1kb MINICIRCLE (>1000 different molecules) 12 pre-edited RNAs 1000s of gRNAs U U U

34 Insertion editing Deletion editing Cleavage Endoribonuclease U addition TUTase Ligation RNA ligase U removal Exo Uase RNA editing mechanism

35 Proteins of the T. brucei 20S Editosome A1 81interaction A2 63interaction A3 42interaction* A4 24interaction A5 19interaction* A6 18interaction* B1 90nuclease* B2 67nuclease* B3 61nuclease* B4 46interaction* B5 44interaction B6 49interaction* B7 47interaction* B8 41interaction* C1 100ExoUase C2 99ExoUase L1 52RNA ligase L2 48RNA ligase T2 57TUTase H1 61Helicase Helicase OB-fold OB-fold? ZZOB-fold OB-fold? ZZOB-fold ZZ?OB-fold LigasetauK LigasetauK 53exoEndo/Exo/Phos 53exoEndo/Exo/Phos RNase IIIdsRBMU1-like RNase IIIdsRBMU1-like RNase IIIdsRBMU1-like RNase III?PumU1-like RNase III?PumU1-like PAPPAP-assoc.cat. name potential role motifs Colored box indicates role demonstrated

36 A6 (18) C2(99)U- A2 (63) L1 T2 A1 (81) L2 INSERTION DELETION 20S editosome interactions in T. brucei by yeast two hybrid, Co-IP, TAP-Tag, catalytic enhancement, knockdown

37 20-30% of disease-causing mutations in humans involve pre-mRNA splicing Cystic fibrosis – C T mutation creates cryptic splice site which creates a short extra exon that contains a stop codon Myotonic dystrophy – mis-regulation of alternative splicing Errors in RNA editing also produce disease Wilms tumor is due to mis-editing Fabry disease is due to mis-editing RNA processing and disease


Download ppt "RNA PROCESSING DNA MATURE RNA PROTEIN PRECURSOR RNAs pre-rRNA pre-tRNA pre-mRNA Cleavage Nucleotide addition Nucleotide insertion Nucleotide removal Sequence."

Similar presentations


Ads by Google