1. Hillary Term 04: “The Human Genome” 20.1 The Human Genome – evolutionary issues (Hein) 27.1 Non-Genic Selection in the Human Genome (Lunter) 3.2 Mammalian Genes I: Conservation and slow evolution (Ponting) 10.2 Mammalian Genes II: Functional innovation and rapid change (Ponting/Goodstadt) 17.2 RNAs in Human Genome (Sam Griffiths-Jones) 24.2 Population Genetics of the Human Genome (Gil McVean ) 2.3 Association Mapping and the Human Genome (Lon Cardon) 9.3 The Human Genome and Human Evolution (Chris Tyler-Smith)

2. The Human Genome – key issues The Human Genome Project Few basic facts of the human genome Grammar of Genes Basic events happening to a genome per mitosis/generation Genealogical Structures: Phylogenies, Pedigrees and the ARG Long term Dynamics of the Human Genome: The comparative aspect (Genotype  Phenotype) & (Population Genetics/History) => Gene Mapping History Our interests.

3. History of the Human Genome Project Strachan and Read, HMG3 p213 1956 Physical map. 24 types and total set of 46 chromosomes 1977 Sanger publishes dideoxy sequencing method 1980 Botstein proposes human genetic map using RFLPs 1987 US DOE publishes report discussing HGP 1988 HUGO is established 1990 Official start of HGP with 3 billion $ and a 15 year horizon. 1991 Genome Database GB is established 1992 Genethon publishes map based on microsatelites. 1995 Lander et al. detailed map based on sequence tagged sites. 1998 Comprehensive map based on gene markers. 1999 Sanger Centre publishes chromosome 22 2001 Draft Genome published: Celera & Public 2003 Completion (almost) of Human Genome

4. Public effort- strategy: Celera - strategy: From Myers 99 Sequencing Strategies Celera’s view of International Consortium International Consortium’s view of Celera Unfair competition: IC delivering the same goods but with state funding. Unfair competition: Celera delivering the same goods but can use IC data, while IC cannot use Celera data.

5. Other Genome Projects 1976/79 First viral genome – MS2/fX174 1980 Mitochondrion 1982 First shotgun sequenced genome – Bacteriophage lambda 1995 First prokaryotic genome – H. influenzae 1996 First unicellular eukaryotic genome – Yeast 1998 The first multicellular eukaryotic genome – C.elegans 2000 Drosophila melanogaster 2000 Arabidopsis thaliana 2001 Human Genome 2002 Mouse Genome The Genome OnLine Database knows of 958 genome sequencing projects, of which 169 are completed

6. Favourite and Model Organisms Multicellular Animals Mammals Human 3.5 Gb Mouse 3.2 Gb Cow 3.0 Gb Dog 2.8 Gb Rat 3.1 Gb Chimp 3.5 Gb Pig 3.0 Gb Fish Puffer Fish 0.4 Gb Zebra Fish 1.9 Gb Insects Drosophila 165 Mb Honey Bee 270 Mb Yellow Fever Mosquito 780 Mb Malaria Mosquito 278 Mb Strachan and Read (2004) Chapter 8 Birds Chicken 1.2 Gb Frog Xenopus Laevis 1.7 Gb Nematodes Caenorhabdites elegans 100 Mb Caenorhabdites briggsae 80 Mb Sea Urchin Strongylocentrotus purpuratus 800 Mb Multicellular Plants Arabidopsis thaliana 125 Mb Rice 430 Mb

7.  globin Exon 2 Exon 1 Exon 3 5’ flanking 3’ flanking (chromosome 11) The Human Genome I http://www.sanger.ac.uk/HGP/http://www.sanger.ac.uk/HGP/ & R.Harding & HMG (2004) p 245 *5.000 *20 6*10 4 bp 3.2*10 9 bp *10 3 3*10 3 bp ATTGCCATGTCGATAATTGGACTATTTGGA30 bp Myoglobin  globin aa DNA: Protein: 1 23 4 5 6 7 8 9 X Y 15 14 13 12 10 11 21 20 19 18 17 16 22 279 251 221 197 198 176163148 140 143 148 142 118 107 100 104 88 86 72 66 45 48 163 51 mitochondria.016

8. The Human Genome II http://www.sanger.ac.uk/HGP/ Strachan and Read (2004) Chapter 9 Nuclear Genome Mitochondria Highly conserved - coding 1.5% 93% Highly conserved - other 3.5% 5% Transposon based repeats 45 % - Heterochromatin 6.6% - Other non-conserved 44 % 2% Mendelian inheritance Maternal inheritance 1 (typically) Possibly thousands Recombination No recombination Gene Density: 1/130 kb 2 kb Pseudogenes: 20000 Processed Pseudogenes

9. The Human Genome III http://www.sanger.ac.uk/HGP/ Strachan and Read (2004) Chapter 9 + Lander et al.(2001) Gene families Clustered  -globins (7), growth hormone (5), Class I HLA heavy chain (20),…. Dispersed Pyruvate dehydrogenase (2), Aldolase (5), PAX (>12),.. Clustered and Dispersed HOX (38 – 4), Histones (61 – 2), Olfactory receptors (>900 – 25),… Transposons

10. Genes and Gene Structures I Presently estimated Gene Number: 24.000 (reference: ) Average Gene Size: 27 kb The largest gene: Dystrophin 2.4 Mb - 0.6% coding – 16 hours to transcribe. The shortest gene: tRNA TYR 100% coding Largest exon: ApoB exon 26 is 7.6 kb Smallest: <10bp Average exon number: 9 Largest exon number: Titin 363 Smallest: 1 Largest intron: WWOX intron 8 is 800 kb Smallest: 10s of bp Largest polypeptide: Titin 38.138 smallest: tens – small hormones. Intronless Genes: mitochondrial genes, many RNA genes, Interferons, Histones,.. Jobling, Hurles & Tyler-Smith (2004) HEG p 29 + HMG chapt. 9

11. Genes and Gene Structures II Genes within Genes: Intron 26 of neurofibromatosis type I (NF1) contains 3 internal (2 exons) genes in the opposite direction. Overlapping Genes: Class III region of HLA Strachan and Read (2004) Chapter 9 p 258 Simple Eukaryotic

12. Alternative Splicing Cartegni,L. et al.(2002) “Listening to Silence and understanding nonsense: Exonic mutations that affect splicing” Nature Reviews Genetics 3.4.285- HMG p291-294 1.A challenge to automated annotation. 2.How widespread is it? 3.Is it always functional? 4.How does it evolve?

13. RNAs in the Genome Strachan and Read (2004) p.247 F9.4 ~200 snoRNA small nucleolar, over 100 types - RNA modification and processing ~100 snRNA small nuclear - involved in splicing ~200 miRNA very small ~22bp, regulation ~175 28S,5.8S,5S large cytosolic subunit ~175 18S small mitochondrial subunit ~250 5S large mitochondrial subunit >500 tRNA transfer RNA >1500 Antisense RNA > 1500 types

14. Genome Annotation Ensembl http://www.ensembl.org Santa Cruz Genome Browser http://genome.ucsc.edu/http://g Genomes Proteins ESTs

15. Gene Finding and Protein (HMM) Descriptors Burge & Karlin jmb 96 A.Make gene characteristics to each nucleotide. Extract legal prediction by dynamical programming. B. Use HMM to describe biological knowledge of gene structure.

16. Mutations and Mutation Rates 1 mitosis or generation Average Number of Mitoses Male generation (15:35.. 20:150 Female generation: ~24 Crow,JF (2000) “The Origins, Patterns and Implications of Human Spontaneous Mutation” Nature Review Genetics 1.1.40-47 + Strachan and Read (2004) chapter 11 +Jobling, Hurles and Tyler- Smith (2004) chapter 2 Single nucleotide substitutions: ~10 -7 Microsatellites (~100.000): ~10 -2 Small insertion deletions: ~10 -8

17. Recombination 1 meiosis Lander et al.(2001) “Initial sequencing and analysis of the human genome” Nature 409.860-912. + Kong,E. et al.(2002) “A high resolution recombination map of the human genome” Nature Genetics Recombination: Gene Conversion: Total Haploid length males: 25.9 M - females: 44.6 M. Gene conversions 1-2 orders higher. Length 300-2000 pb.

18. Selection: Positive & Negative A A A A A A One sequence scenarioPopulation scenario A A A C C A A A C C A A A C C ThrSer ACGTCA Pro ThrPro ACGCCA ThrSer ACGCCG ArgSer AGGCCG ThrSer ACTCTG AlaSer GCTCTG AlaSer GCACTG - - One sequence scenario again Certain events have functional consequences and will be selected out. The strength and localization of this selection is of great interest. The selection criteria could in principle be anything, but the selection against amino acid changes is without comparison the most important.

19. The Genetic Code Substitutions Number Percent Total in all codons 549 100 Synonymous 134 25 Nonsynonymous 415 75 Missense 392 71 Nonsense 23 4

20. Examples of rates remade from Li,1997 RNA Virus Influenza A Hemagglutinin 13.1 10 -3 3.6 10 -3 Hepatitis C E 6.9 10 -3 0.3 10 -3 HIV 1 gag 2.8 10 -3 1.7 10 -3 DNA virus Hepatitis B P 4.6 10 -5 1.5 10 -5 Herpes Simplex Genome 3.5 10 -8 Nuclear Genes Mammals c-mos 5.2 10 -9 0.9 10 -9 Mammals a-globin 3.9 10 -9 0.6 10 -9 Mammals histone 3 6.2 10 -9 0.0 Organism Gene Syno/year Non-Syno/Year

21. Genealogical Structures Homology : The existence of a common ancestor (for instance for 2 sequences) Phylogeny Pedigree: Ancestral Recombination Graph – the ARG ccagtcg ccggtcg cagtct Only finding common ancestors. Only one ancestor. i. Finding common ancestors. ii. A sequence encounters Recombinations iii. A “point” ARG is a phylogeny

22. Populations Now Parents Grand parents

23. Genealogical approach to Population Variation Analysis Africa Non-Africa Inter.SNP Consortium (2001): A map of human genome sequence variation containing 1.42 million SNPs. Nature 409.928-33

24. Pedigrees Icelandic http://www.decode.comhttp://www.decode.com + Helgason, A. et al. (2003 June) “A population-wide coalescent analysis of Icelandic matrilineal and patrilineal genealogies: Evidence for a faster evolutionary rate of mtDNA lineages than Y-chromosomes” American Journal Human Genetics. Chinese http://demography.anu.edu.au/People/Staff/zhongwei.html Burke’s British Peerage http://www.burkes-peerage.net/sites/wars/sitepages/home.asp Mormons http://genealogy-mormons.com/ Quebec French Heyer and Tremblay, 1998 PNAS Total Pedigree Helga son

25. Genealogical Questions Pedigrees Time back to first individual common ancestor to everyone ARG questions: The height of ARGs - correlation between local phylogenies Gene Phylogeny Questions Total Branch Length - Height

26. Long Term Evolutionary History: Myr/Gyr Origin of Life Last Universal Common Ancestor – LUCA First Eukaryotes First Chordates First Vertebrates First Mammals First Primates First Hominoids Chimp-Human Split Hedges, SB (2002) “The Origin and Evolution of Model Organisms” Nature Review Genetics 3.11.838-848. Brown (2003) “Horizontal Genetic Transfers “ Nature Genetics

27. observable Parameters:time rates, selection Unobservable Evolutionary Path observable MRCA-Most Recent Common Ancestor ? 3 Problems: i. Test all possible relationships. ii. Examine unknown internal states. iii. Explore unknown paths between states at nodes. ATTGCGTATATAT….CAG Time Direction The Comparative Aspect.

28. Observable Unobservable U C G A C A U A C Goldman, Thorne & Jones, 96 RNA Structure Gene Structure One Principle of Comparative Genomics Protein Structure

29. Molecular Evolution and Gene Finding: Two HMMs Simple ProkaryoticSimple Eukaryotic AGTGGTACCATTTAATGCG..... P coding {ATG-->GTG} or AGTGGTACTATTTAGTGCG..... P non-coding {ATG-->GTG}

30. The Rise of Comparative Genomics Lander et al(2001) Figure 25A

31. RNA (Secondary) Structure Sequences ACTGT ACTCCT Protein Structure 87 6 5 43 2 1 4 Cabbage Turnip 7 5 3 1 8 62 Gene Order/Orientation. Gene Structure Interaction Networks Any Graph. General Theme. Formal Model of Structure Stochastic Model of Structure Evolution. Renin HIV proteinase The Domain of Comparative Genomics

32. Linkage Mapping r M D From McVean

33. A set of characters. Binary decision (0,1). Quantitative Character. Dominant/Recessive. Penetrance Spurious Occurrence Heterogeneity genotype Genotype  Phenotype phenotype 2N e generations Association/Fine scale mapping

34. Single marker association Bayesian analysis 1000 cases and 1000 controls typed at 8 microsatellite markers BRCA2 example Rafnar et al.(2004) – Morris et al(2001) + Causative SNPs.

35. Short Term Evolutionary History: Kyr/Myr Oldest Polymorphisms Neutral Human Autosomal Polymorphisms First Out-of-Africa Anatomically Modern Man Peopling of the Globe – genetic and fossil evidence. The globe & migrations: Cavalli-Sforza,2001 + HEG (2004) Supposedly well behaved populations Iceland Finland Sardinia

36. HapMap “The International HapMap Project “Nature 426, 789 - 796 (18 Dec 2003) http://www.hapmap.org/http://www.hapmap.org/ Started October 27-29, 2002

37. HapMap

38. Ontologies http://www.geneontology.org Gene Ontology Consortium (2001) “Creating the Gene Ontology Resource: Design and Implementation.” Genome Research 11.1425-33 Gene Ontology Consortium (2004) “The Gene Ontology (GO) database and informatics resource” Nucleic Acid Research 32.D258-61. A Structured Vocabulary – Consistent across species. Purpose: Facility communication among researchers Facility communication among computer systems 2001: Three Ontologies: Molecular Function Biological Process Cellular Component Source NAR(2004) 32.D258-

39. Structural Genomics: Systematic Structure Determination http://www.strgen.org/http://www.strgen.org/ http://www.nysgrc.org/ http://www.oppf.ox.ac.uk/ http://pdb.ccdc.cam.ac.uk/pdb/strucgen.htmlhttp://www.nysgrc.org/http://pdb.ccdc.cam.ac.uk/pdb/strucgen.html John Westbrook, Zukang Feng, Li Chen, Huanwang Yang and Helen M. Berman “The Protein Data Bank and structural genomics” Nucleic Acids Research, 2003, Vol. 31, No. 1 489-491 PDB Holdings List: 10-Feb-2004 Molecule Type Proteins, Peptides, and Viruses Protein/Nucleic Acid Complexes Nucleic AcidsCarbohydratestotal Exp. Tech. X-ray Diffraction and other 190148987191420645 NMR29349656943603 Total2194899412881824248 Examples: Center for Eukaryotic Structural Genomics Structural Genomics of Pathogenic Protozoa Consortium Berkeley Structural Genomics Center : Mycoplasma genitalium and Mycoplasma pneumoniae

40. Structural Genomics: Mycoplasma pneumoniae proteins http://www.strgen.org/status/mpoverview.html

41. Proteomics http://www.hupo.orghttp://www.hupo.org Hanash,S.(2003) “Disease Proteomics” Nature 422.226- Aebersold,R. and M.Mann (2003) “Mass spectrometry-based proteomics” Nature 422.198- Gavin et al. (2002) “Functional Organisation of the Yeast Proteome by systematic analysis of protein complexes” Nature 415.141- 2D PAGE gels (polyacryl gel electrophoresis ) MALDI Protein Micro-arrays Source: Hanash (2003) Source Gavin et al.(2002)

42. The Genome Genomes: Variation and long term evolution. Genealogical Structures: Phylogenies, Pedigrees and the ARG Long term Dynamics of the Human Genome: The comparative aspect (Genotype  Phenotype) & (Population Genetics/History) => Gene Mapping Summary

43. Our Genomically Motivated Projects 1.Comparative gene annotation (Meyer, Skou Pedersen) 2.Superimposed selective constraints (Forsberg, Meyer, Skou Pedersen) * 3.Haplotype Blocks (Song) * 4.Genome transformations (Miklos) 5.Ancestral Blocks* 6.Statistical Sequence Comparison (Drummond, Lunter, Miklos) 7.Substitutions and insertion-deletions at the Genome Level (Lunter) Next week

44. a: (3,4) b: (3,4) c: (15,16) d: (16,17) e: (35,36) f: (35,36) g: (36,37) Minimal ARGs and Haplotype Blocks (Song)

45. Combining Levels of Selection. Forsberg, Meyer, Pedersen Protein-Protein Hein & Støvlbæk, 1995 Codon Nucleotide Independence Heuristic Jensen & Pedersen, 2001 Contagious Dependence Assume multiplicativity: f A,B = f A *f B Protein-RNA DoubletsSinglet Contagious Dependence

46. A randomly picked ancestor: (ancestral material comes in batteries!) 0 0 52.000 260 Mb 0 6890 8360 7.5 Mb *35 0 30kb *250 Parameters used 4N e 20.000 Chromos. 1: 263 Mb. 263 cM Chromosome 1: Segments 52.000 Ancestors 6.800 All chromosomes Ancestors 86.000 Physical Population. 1.3-5.0 Mill. Applications to Human Genome (Wiuf and Hein,97)

47. References: Books & www-pages. Books: Strachan and Read (2004) “Human Molecular Genetics” (3 rd Ed.) Bioscience Jobling, Hurles and Tyler-Smith (2004) “Human Evolutionary Genetics” Bioscience Sulston, J.(2002) “Our Common Thread” Corgi Books Ridley, Matt (2001) “Genome” “Encyclopedia of the Human Genome” (2003) Nature Publishing Group Cavalli-Sforza,L. (2001) “Genes, People and Language” Penguin Key articles: Lander et al.(2001) “Initial Sequencing and Analysis of the Human Genome” Nature Venter et al.(2001)”The Sequence of the Human Genome” Science 291.1304-1351

48. References: www-pages. Major sequencing centers: Baylor College of Medicine Genome Sequencing Center hgsc.bcm.tcm.edu/hgsc.bcm.tcm.edu/ Celera www.celera.comwww.celera.com DoE Joint Genome Institute www.jgi.doe.govwww.jgi.doe.gov Genoscope www.genoscope.cns.frwww.genoscope.cns.fr TIGR www.tigr.orgwww.tigr.org Washington University Genome Sequencing Center www.genome.wustl.eduwww.genome.wustl.edu Wellcome Trust Sanger Institute www.sanger.ac.ukwww.sanger.ac.uk Whitehead Institute/MIT Center for Genome Research www.-genome.wi.mit.eduwww.-genome.wi.mit.edu Ensembl genome annotator - www.ensembl.orgwww.ensembl.org European Bionformatics Institute - www.ebi.ac.ukwww.ebi.ac.uk NCBI - www.ncbi.nlm.nih.govwww.ncbi.nlm.nih.gov Nature Genome Gateway http://www.nature.com/genomics/human/http://www.nature.com/genomics/human/ Integrated Genomics http://wit.integratedgenomics.com/GOLD/http://wit.integratedgenomics.com/GOLD/ Ebi genome databases http://www2.ebi.ac.uk/genomes/http://www2.ebi.ac.uk/genomes/ Primate Sequencing Projects http://sayer.lab.nig.jp/~silver/index.htmlhttp://sayer.lab.nig.jp/~silver/index.html European Bioinformatics Institute Proteomics http://www.ebi.ac.uk/proteome/http://www.ebi.ac.uk/proteome/ National Center for Biotechnology Information http://www.ncbi.nlm.nih.gov/http://www.ncbi.nlm.nih.gov/ HapMap Project Homepage http://www.hapmap.org/http://www.hapmap.org/ Online Inheritance in Man http://www.ncbi.nlm.nih.gov/omim/http://www.ncbi.nlm.nih.gov/omim/