Presentation is loading. Please wait.

Presentation is loading. Please wait.

Chromosome abnormalities Dr Cédric Le Caignec Service de Génétique Médicale CHU Nantes.

Similar presentations


Presentation on theme: "Chromosome abnormalities Dr Cédric Le Caignec Service de Génétique Médicale CHU Nantes."— Presentation transcript:

1 Chromosome abnormalities Dr Cédric Le Caignec Service de Génétique Médicale CHU Nantes

2 1. Chromosome abnormalities or rearrangements 2. Gene defects: mutations Genetic anomalies

3 Level of resolution Chromosomal band: 5-10 Mb Genome: 3x10 9 bases ATGCACTGATGAATGCATGCAAT A gene: about 20 kb From 1 b to 1000 b Molecular level Cytogenetic level

4 Chromosome abnormalities Different types Balanced anomalies: associated with a normal phenotype for the majority 11 22

5 Different types Balanced anomalies: associated with a normal phenotype for the majority Unbalanced anomalies: with a gain or a loss of genetic material usually with abnormal phenotype Chromosome abnormalities

6 At birth 0.6 à 0.9% of the newborns carry a chromosomal anomaly Third trimester miscarriages: 5% of the fetuses carry a chromosomal anomaly First trimester miscarriages: 60% of the fetuses carry a chromosomal anomaly  high pressure of selection during fetal development Chromosome abnormalities

7 Constitutional / Acquired Homogeneous / Mosaic Chromosome abnormalities

8 Mitosis Meiosis Birth Fecundation

9 Constitutional / Acquired Homogeneous / Mosaic Numerical / structural Balanced Unbalanced Chromosome abnormalities

10 Numerical abnormalities

11 Numerical abnormalities : the ploidy Diploidy (normal somatic cell) : 2 haploïd sets of chromosomes

12 Numerical abnormalities : the ploidy Diploidy (normal somatic cell) : 2 haploïd sets of chromosomes Polyploidy : more than 2 haploïd sets of chromosomes (ex: triploidy)

13 Anomaly at fecundation Triploidy : 69,XXX or 69,XXY or 69,XYY Tetraploidy : 92,XXYY or 92,XXXX (hemopathies, tumors) Numerical abnormalities : polyploidy

14 69,XXX Numerical abnormalities : example of a triploid cell

15 Diploidy (normal somatic cell) : 2 haploïd chromosome sets Polyploidy : more than 2 haploïd chromosome sets (ex: triploidy) Aneuploidy : Gain of one (or more) chromosome (trisomy) Loss of one (or more) chromosome (monosomy) Numerical abnormalities :

16 Numerical abnormalities : example of trisomy 21 (autosome)

17 Numerical abnormalities : example of monosomy X

18 Mechanisms of the aneuploidies Non-disjunction in meiosis First division in meiosis I Second division in meiosis II Post-zygotic mitotic non-disjunction

19 MI MII Mechanisms of the aneuploidies: meiosis I non disjunction Most often: homogeneous anomaly

20 MI MII Mechanisms of the aneuploidies: meiosis II non disjunction Most often: homogeneous anomaly

21 Mechanisms of the aneuploidies Non-disjunction in meiosis First division in meiosis I Second division in meiosis II Post-zygotic non-disjunction in mitosis

22 Most often: mosaics Mechanisms of the aneuploidies: post-zygotic non-disjunction in mitosis Zygote (post Fecundation)

23 mat MI MII pat Trisomy 21 91% 75% Trisomy 18 93% 60% Trisomy 13 88% 45,X 80% 47,XXY 53% 47% Aneuploidies

24 STRUCTURAL ANOMALIES

25 Structural anomalies Balanced ---> Normal phenotype but risk to future offspring Unbalanced Deletion Duplication Derived chromosome ---> usually associated with abnormal phenotype

26 Structural anomalies Only one chromosome involved One breakage: terminal deletion Two breakages: one arm:interstitial deletion paracentric inversion two arms:pericentric inversion ring chromosome isochromosome Two chromosomes involved Robertsonian translocation Reciprocal translocation

27 Structural anomalies Only one chromosome involved One breakage: terminal deletion

28 breakage loss neotelomere del(4)(p15.3) Terminal deletions (del) One breakage:terminal deletion

29 4p deletion 5p deletion : Cri du chat syndrome Terminal deletions (del)

30 Structural anomalies Only one chromosome involved One breakage:terminal deletion Two breakages:one arm:interstitial deletion

31 Two breakpoints Interstitial deletions Two breakpoints on the same chromosome arm and loss of the chromosome region between: interstitial deletion loss of the chromosome region between

32 Anomalies de structure Only one chromosome involved One breakage:terminal deletion Two breakages:one arm:interstitial deletion paracentric inversion two arms:pericentric inversion ring chromosome isochromosome Two chromosome involved Robertsonian translocation: centric fusion

33 Robertsonian translocations Involve two acrocentric chromosomes Breakpoints located at the centromere or close to Loss of the short arms Loss of a centromere Karyotype with 45 chromosomes Consequences in meiosis

34 rob(13;14)(q10;q10) ou der(13;14)(q10;q10) loss fusion normal phenotype but clinical consequences Robertsonian translocations (rob ou der)

35 45,XX,rob(14;21)(q10;q10) Loss of the short arm(s) of chromosomes 14 and 21 Normal phenotype

36 1421 der (14;21)(q10;q10) Risk to future offspring ? 50 % ? Trisomy 14 ? Trisomy 21 ?

37 pachytene

38 alternate segregation pachytene balancednormal balanced normal gametes zygotes

39 adjacent segregation trisomy 21 disomy 21 gametes zygotesmonosomy 21 nullosomy 21 miscarriage

40 46,XY,der(14;21)(q10;q10),+21 trisomy 21

41 adjacent segregation monosomy 14 nullosomy 14 miscarriage trisomy 14 disomy 14 gametes zygotes miscarriage

42 der(14;21)(q10q10) the majority of the familial trisomy 21 (1/2 de novo ; 1/2 inherited) different risk when maternally or paternally inherited Maternally inherited : trisomy 21 risk: 15 % Paternally inherited : trisomy 21 risk : 2 % Genetic counseling

43 der(21;21)(q10;q10) Rarely inherited When inherited: 100% risk of trisomy 21 in the offspring Genetic counseling

44 der(13;14)(q10;q10) frequent (~ 1/1200) low risk: trisomy 13 ( ~ 1%) Genetic counseling

45 45,XY,der(13;14)(q10:q10)

46 Structural anomalies Only one chromosome involved One breakage: terminal deletion Two breakages: one arm:interstitial deletion paracentric inversion two arms:pericentric inversion ring chromosome isochromosome Two chromosome involved Robertsonian translocation Reciprocal translocation

47 t(6;18)(p24;q21.2) fusion Translocations (t) Two breakpoints located on two different chromosomes followed by an exchange: reciprocal translocation

48 Reciprocal translocations Normal phenotype when balanced When abnormal phenotype (rarely): Gene interrupted at one of the breakpoint microdeletion or microduplication Breakpoint anomaly

49 46,XX,t(11;22)(q23.3;q11.2)

50 t (11;22)(q23.3;q11.2) 1122 Reciprocal translocations

51 46,XX,t(11;22)(q23.3;q11.2) Electronic microscopy Pachytene stage

52 Different modes of segregations segregations 2:2 alternate adjacent 1 adjacent 2 segregations 3:1 4 possible combinations segregation 4:0 Number of gametes in theory 16 possible combinations but not equal

53 normal gamete balanced gamete pachytene Alternate segregation

54 pachytene gametes zygotes Partial monosomy and trisomy trisomy 11q dist. monosomy 22q dist. trisomy 22q dist. monosomy 11q dist. Adjacent 1 segregation

55

56 You see a 25 years old patient for sterility without any anomalies. His karyotype is 45,XY,rob(14;21)(q10;q10) How do you interpret this result ?

57 Robertsonian translocations Involve two acrocentric chromosomes

58 XY Among the autosomes, 5 pairs of acrocentric chromosomes : 13, 14, 15, 21 and 22

59 Robertsonian translocations Involve two acrocentric chromosomes Breakpoints located at the centromere or close to Loss of the short arms Loss of a centromere Karyotype with 45 chromosomes Consequences in meiosis

60 rob(13;14)(q10;q10) ou der(13;14)(q10;q10) loss fusion normal phenotype but clinical consequences Robertsonian translocations (rob ou der)

61 45,XX,rob(14;21)(q10;q10) Loss of the short arm(s) of chromosomes 14 and 21 Normal phenotype

62

63


Download ppt "Chromosome abnormalities Dr Cédric Le Caignec Service de Génétique Médicale CHU Nantes."

Similar presentations


Ads by Google