Presentation is loading. Please wait.

Presentation is loading. Please wait.

Current Sequencing Effort of Tomato Chromosome 2 Sunghwan Jo, KRIBB.

Similar presentations


Presentation on theme: "Current Sequencing Effort of Tomato Chromosome 2 Sunghwan Jo, KRIBB."— Presentation transcript:

1 Current Sequencing Effort of Tomato Chromosome 2 Sunghwan Jo, KRIBB

2 Identical segment duplication/ Chimera BAC clone? What is best way to speed up sequencing progress? Increase seed BACs!?

3 Redundant sequence in chromosome 2

4 Mbo108P14 (34290bp) HBa323A cM (128329bp) Hba059M17, 67cM (115036bp) 65331bp bp bp 26007bp 9.1kb 25.2kb Mbo008E03 71cM (46,886bp) HBa204D01 73cM (179,870bp) 1 1 ~28Kb Case 1 4.9kb

5 (RC) M108P14 H323A14 M108P14-confirm (455bp) M108P14H323A14 M108P14 -confirm (455bp) CATTTTATGCTGGCGAAACC LEFT PRIMER ACCCTTCCTCTTGCATCCTT RIGHT PRIMER M82 Mbo108P14 (34,290bp) HBa323A14 (128,329bp) 65,331bp 1 40,147bp 1 9.1kb 25.2kb 34,290

6 H323A14-M108P14-confirm (462bp) TGTCCGAGTGGATCTCCTTC LEFT PRIMER CATTTTATGCTGGCGAAACC RIGHT PRIMER H323A14-M108P14-confirm (462bp) M108P14H323A14M82H059M17 Mbo108P14 (34,290bp) HBa323A cM (128,329bp) H059M17, 67cM (115,036bp) 65331bp bp bp 26007bp 9.1kb25.2kb 4.9kb

7 Mbo108P14 (34,290bp) HBa323A cM (128,329bp) H059M17, 67cM (115,036bp) 65,331bp 1 40,147bp 1 16,907bp26,007bp 9.1kb25.2kb 4.9kb H059M17-confirm (421bp) GTGGTGGGATCAACCTGTCT LEFT PRIMER TGCATGGCAATTTTGTATCC RIGHT PRIMER H059M17-confirm (421bp) M108P14M82H059M17

8 No segmental duplication but chimera clone Mbo108P14 (34,290bp) HBa323A cM (128,329bp) H059M17, 67cM (115,036bp) 65,331bp 1 40,147bp 1 16,907bp26,007bp 9.1kb25.2kb 4.9kb

9 E D01 G No segmental duplication but chimera clone Case 2 Mbo008E03 71cM (46,886bp) HBa204D01 73cM (179,870bp) 1 1 ~28Kb

10 Hba75D08_sp6 (74.8cM) Mbo049G16_sp6 (75.0cM) T0702 (76.0cM) H044O16_sp6 (75.1cM) MboI73G04_T7 (75.3cM) 2-I 2-H 2-I Tomato-EXPEN 2000 IL map BAC contig Case 3

11 H075D08 or Hba75D08_sp6 (74.8cM) Contig 1 Contig 2 Contig 3 All contigs are well assembled!!

12 Contig 1 H075D08 H044O16 Contig 3

13 H075D08 Contig 1 Contig 2

14 H075D08 H044O16 H075D08 H075D08- H044O16 -confirm (397bp) H044O16 confirm (427bp) GGCCGTTCAACTTGCTCTTA LEFT PRIMER GGCACAAACATGTCAAATGC RIGHT PRIMER GGCCGTTCAACTTGCTCTTA LEFT PRIMER CTGAATTCGCGAACCAATCT RIGHT PRIMER

15 Hba0075D08 (74.8cM) Mbo0049G16 (75.0cM) T0702 (76.0cM) Hba044O16 (75.1cM) MboI73G04 (75.3cM) M020N15 TO-M073G04 Hba0044O Hba0075D08 H165K22 TO-H228I09 Mbo0049G16 M021D D08 44O16 G 75D08 49G16 G

16 Contig 1 H075D08 H044O16 Contig 3

17 TG426 TG48 TG147 TG426 (89.3cM) TG48 (92cM) TG147 (96cM) H011A02 TG373 (94cM) Case 4 80kb

18 H125L12 (12,174bp) 1bp E011K05 (91,579bp) 671bp6,462bp 5,798bp H125L12 (12,174bp) T0493 (48.0 cM) Expect 11,466bp E011K05 (91,579bp) H125L12 E011K05 Sequence result Dot-Matrix result Two sequence alignment result 2_G Case 5

19 Summary NameGenomeEnzyme siteNameGenomeEnzyme site Mbo108P14XOHBa075D08XX Mbo008E03XOMbo049G16OX HBa323A14OXHBa044O16XX HBa059M17OX

20 Probably, chimeric BAC clones Were selected as “Next BAC “ clones during extension process 1.Chimeric BAC clone itself exist in libraries but not in genome. 2. Not all strange BAC clones have enzyme site.

21 What is best way to speed up sequencing progress? Increase seed BAC 64 Seed BACs 74 Extended BACs 28 contigs 16 single BAC + increase extending chance - Increase overlap length

22 Seed BACsBAC extensionTotal reading length Non- overlapped reading length ,016k b 10,888kb ContigsingleAverage overlap % done (22Mb) kb49.5% BAC Sequencing Summary

23 Difference between the order of Genetic marker and sequence result cosII Increase overlap length or lost BAC sequence


Download ppt "Current Sequencing Effort of Tomato Chromosome 2 Sunghwan Jo, KRIBB."

Similar presentations


Ads by Google