Presentation is loading. Please wait.

Presentation is loading. Please wait.

Trypanosomy v lidské krvi. Euglenozoans are unicellular flagellates that include free-living, commensalic and parasitic species Euglenids DiplonemidsKinetoplastids.

Similar presentations


Presentation on theme: "Trypanosomy v lidské krvi. Euglenozoans are unicellular flagellates that include free-living, commensalic and parasitic species Euglenids DiplonemidsKinetoplastids."— Presentation transcript:

1 Trypanosomy v lidské krvi

2 Euglenozoans are unicellular flagellates that include free-living, commensalic and parasitic species Euglenids DiplonemidsKinetoplastids

3 the sampling of trypanosomatids in Neotropical Heteroptera

4 trypanosomes Kinetoplastid flagellates causing disease: > patients worldwide Leishmaniasis Chagas’ disease Sleeping sickness Trypanosoma brucei

5 Trypanosoma brucei T.brucei gambiense T. brucei rhodesiense T. brucei brucei tse-tse fly vector life cycle distribution

6 kDNA is organized as a disc with minicircles stretched taut and aligned parallel to the axis of the kDNA disc mitochondrion kDNA

7 Kinetoplast (or kDNA) genome of kinetoplastid flagellates gRNA 1 gRNA 2 gRNA 3 ~1kb ND8 ND9 ND7 COII MURF2 CR4 CR5 RPS12 A6 CYb COIII CR3 22kb Trypanosoma brucei

8 Topo II Kinetoflagellar Zone SSE1 (RNase H) Pol  Primase UMSBP Pol  -PAK Pol1B Pol1C Antipodal site The kinetoplast DNA replication model +

9 IscS1 Frataxin (komplex ?) IscA Ferredoxin 1 Ferredoxin 2 Zájmové mitochondriální proteiny 1.Fe-S klastery 2. RNA editing a RNA procesing 3.proteiny konzervované mezi člověkem, kvasinkou a trypanosomou o nichž se nic neví 4.Podjednotky respiračního řetězce 5.Import a modifikace tRNA

10 GAP1 and 2 are lethal also in the bloodstream stage Northern and Western analysis showing downregulation of the GAP proteins Growth curves of GAP knock-downs gRNAs disappear in the absence of GAP proteins

11 Mrs3/4 IscS Isd11 Frataxin Atm1? apoprotein cysteine alanine Fe 2+ S 0 Grx5 e Fdx IscU substrate ISC machinery Hsp70 DnaJ Mge IscA Erv1, GSH Iba57? TCA Nfu Fe S ATP FOR-NADH S Fe Complex I Ind mitochondrion S S Fe S apoprotein s s Narf Nbp35 S Fe S Cfd1WD40 s s S Fe S X?

12 Central Dogma of Molecular Biology

13 T. brucei ATPase 6 mRNA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAU UGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAA AGGGAAAGUUGUGAUUUUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA M K E K G F E R G V F W G E E K E F W I W T I C L S Y G R E A R R R K V G E F W G D S W G E A G G R R R F W K H P F L G G ter E G R K G E M E L G I A F A K L L E E R A G K V R G R R E E R E S C D F G V I E ter D Q I S terter pre-edited AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAU UGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAA AGGGAAAGUUGUGA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAU UGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAA AGGGAAAGUUGuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAU UGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAA AGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUA AUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAU UGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGGUUAGGGGGuuuAGuuuuGuA uuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGU UAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAUUGGGAAU UGCCUUUGCCAAACUUUUAGAAGAAAGAGCAGGAAAGG**AuuuuuuGuuGuuuuuGu uGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG* *GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGAAAUGGAAuUUGuuGG AuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGC AGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuu uuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAU AAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGGAGAAAAGGGGuuuAuuAuuuuAUGuG uuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuu uGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuA GuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA* *UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAAGAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuA uuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUU uGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAu AAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAG uuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCA AAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGAUUCUUGGGGAGAGGCGGGCGGGCGACGGCGGUUUU GAAAACACCCAUUUUUAGGAGGAUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuu GuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuu uuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuG uAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGu uuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**U UGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAAGCAAGGAGGAGA AAAGUAGGGGAAUUUUGAGGAGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGA GuGuuuuuCuuuGuuGuGuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuA uuAuCAuCCCAuUUUUUAuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuu uuuuuuuuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuu GuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC* ***AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuG uuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGA AAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACUAUUUGUUUAAGUUAUGGGAGAGAuAuuGCAuuuuuA uuuuuGuuuuGuuuuuuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA ****GuuuuAuGGAuGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuu uuCuuuGuuGuGuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCA uCCCAuUUUUUAuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuu uuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAu uAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGu uAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuG uuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG **GuuUGuuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGGGGAGGA AAAAGAAUUUUGAAUUUGAACuUAUUUG***AAuuuG*UAuuUGuuGuuuuGuAuuGu uuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGuuuuGuuuuuuAuGuGAuuuuuuuuuG uuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAuGGAuGuuuuuuuuAUUC**Guu uuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGuGuCGuuGuuuGuCGACGuuuuu GCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUUAuuGuuGAuGuuuuuuGAuuuu uuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGuuAuuGAuuuAuuuuAuuu AuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuAuAuUUGuuGGAuuuAU UuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAuAuGAuuuuGCAGuuGA uAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuGuAuuuGAuuuuuGAuA GuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGAGUUAUAGAAUAAGAUC AAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAAAUGAAGGAGAAAGGUUUUGAGAGGGGGGUUUUUUGAGuuGuGGu uuAuGuuGuuuAAuuuAuAuAGuuuAAUUUUGuAuuA*UUGuAuuACuUAUUUG***A AuuuG*UAuuUGuuGuuuuGuAuuGuuuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGu uuuGuuuuuuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****Guu uuAuGGAuGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuG uuGuGuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuU UUUUAuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGG uuuuuuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuA UGuGuuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAu uuuuuGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuG uuuAGuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUG uuA**UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGAGGAAUUUUGGGCGGAAGAGAAGG AGACAGGAGAGGAuuuuAAuUGuuuAAuGuuGAuuuuuGAuuuuuuAuuAuuuuGuuu G*UUUGAuuuGuAuuuGuuuGuuGGuuuGuG***UUUGuuuuuAuuGuuGuGGuuuAu GuuGuuuAAuuuAuAuAGuuuAAUUUUGuAuuA*UUGuAuuACuUAUUUG***AAuuu G*UAuuUGuuGuuuuGuAuuGuuuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGuuuuG uuuuuuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAu GGAuGuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGu GuCGuuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUU AuuGuuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuu uuGuuAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuG uuuuuAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuu uGuAAuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuA GuuuuGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA* *UUGGAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAAGuuuuuAuuuuuuuuuuGuGAuuuA UUUUGGuuGCGuuuGuuAuuAuGuAuGuAuuAuuGuGuAuGAuCuAGGuuAuGuuuuA uuGuGuAuuuuAAuUGuuuAAuGuuGAuuuuuGAuuuuuuAuuAuuuuGuuuG*UUUG AuuuGuAuuuGuuuGuuGGuuuGuG***UUUGuuuuuAuuGuuGuGGuuuAuGuuGuu uAAuuuAuAuAGuuuAAUUUUGuAuuA*UUGuAuuACuUAUUUG***AAuuuG*UAuu UGuuGuuuuGuAuuGuuuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGuuuuGuuuuuu AuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAuGGAuGu uuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGuGuCGuu GuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUUAuuGuu GAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGuuA uuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuuuA uAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuAAu AuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuuuG uAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUGGA GUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA AAAAAUAAGUAUUUUGAUAUUAUUAAAGUAAAuAuGuuuuuAuuuuuuuuuuGuGAuu uAUUUUGGuuGCGuuuGuuAuuAuGuAuGuAuuAuuGuGuAuGAuCuAGGuuAuGuuu uAuuGuGuAuuuuAAuUGuuuAAuGuuGAuuuuuGAuuuuuuAuuAuuuuGuuuG*UU UGAuuuGuAuuuGuuuGuuGGuuuGuG***UUUGuuuuuAuuGuuGuGGuuuAuGuuG uuuAAuuuAuAuAGuuuAAUUUUGuAuuA*UUGuAuuACuUAUUUG***AAuuuG*UA uuUGuuGuuuuGuAuuGuuuuuuuAuuGuAuAuuGCAuuuuuAuuuuuGuuuuGuuuu uuAuGuGAuuuuuuuuuGuuuAAuAAuuuGuUAGuuGGuGAuA****GuuuuAuGGAu GuuuuuuuuAUUC**GuuuuuuGuuGuGuuuuuuAGAGuGuuuuuCuuuGuuGuGuCG uuGuuuGuCGACGuuuuuGCGuuuGUUUUGuAAuuuAuuAuCAuCCCAuUUUUUAuuG uuGAuGuuuuuuGAuuuuuuuUAuuuuAuuuuuGuuuuuuuuuuuuAGGGuuuuuuGu uAuuGAuuuAuuuuAuuuAuuuuuGuGuuuuGuuuuuGuuuAuuAuuuuAUGuGuuuu uAuAuUUGuuGGAuuuAUUuGCC***GCCAuAuuAC****AGuuAuuuAuuuuuuGuA AuAuGAuuuuGCAGuuGAuAAuGG**AuuuuuuGuuGuuuuuGuuGuuuGuuuAGuuu uGuAuuuGAuuuuuGAuAGuuAuuAuAuuGuuGuuGAAAuuuG**GuuUGuuA**UUG GAGUUAUAGAAUAAGAUCAAAUAAGUUAAUAAUA editing in progress... edited M F L F F F C D L F W L R L L L C M Y Y C V W S R L C F I V Y F N C L M L I F D F L L F C L F D L Y L F V G L C L F L L L W F M L F N L Y S L I L Y Y C I T Y L N L Y L L F C I V F L L Y I A F L F L F C F L C D F F L F N N L L V G D S F M D V F F I R F L L C F L E C F S L L C R C L S T F L R L F C N L L S S H F L L L M F F D F F Y F I F V F F F W C F L L L I Y F I Y F C V L F L F I I L C V F I F V G F I C R H I T V I Y F L ter

14 In T. brucei, extensive RNA editing is the rule: 9 of 18 mRNAs are extensively edited ND9 MURF5 MURF1 ND1 cox1 G4 ND3 12S 9S ND8 ND7 cox3 cytb ATP6 G3 cox2 MURF2 ND4 RPS12 ND5 edited mRNAs

15 CYb III II Complex I Complex IIComplex IIIComplex IVComplex V 6 (a) Most edited mRNAs encode subunits of the OxPhos system Subunits encoded by mitochondrial mRNAs that require editing Succinate reductase

16 ...AAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGUGAUUUUGGAGUUAUAG... |·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAU AGCCUCAAUAUC......AAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGUGAUUGGAGUUAUAG... ||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAA UAGCCUCAAUAUC......AAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGUGuuAUUGGAGUUAUAG... ·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAA GCAAUAGCCUCAAUAUC......AGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGUUGuuUGuuAUUGGAGUUAUAG... ·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGAC UAAGCAAUAGCCUCAAUAUC......AAAGAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAGGuuUGuuAUUGGAGUUAUAG... |·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGA CUAAGCAAUAGCCUCAAUAUC......GAGCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGGAAAuuuGGuuUGuuAUUGGAGUUAUAG... ·||||·||·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGACAG UUUUAGACUAAGCAAUAGCCUCAAUAUC......GCAGGAAAGGUUAGGGGGAGGAGAGAAGAAAGGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG... ||··||||·||·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGA CAGUUUUAGACUAAGCAAUAGCCUCAAUAUC......AGGAAAGGUUAGGGGGAGGAGAGAAGAAAGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG... ··|||··||||·||·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAG UGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC......GAAAGGUUAGGGGGAGGAGAGAAGAAAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG... ||···|||··||||·||·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUA UAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC......AAAGGUUAGGGGGAGGAGAGAAGAAuAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG... ||||···|||··||||·||·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAG UAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC......AGGUUAGGGGGAGGAGAGAAGAuuAuAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG... ||·||||···|||··||||·||·||·|||||·|||||||||| UUUUUUUUUUUUAUUAA UAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC......GUUAGGGGGAGGAGAGAAGuuAuuAuAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG... |·||||·||||···|||··||||·||·||·|||||·|||||||||| UUUUUUUUUUUUA UUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC......UUAGGGGGAGGAGAGAuAGuuAuuAuAuuGuuGuuGAAAuuuGGuuUGuuAUUGGAGUUAUAG... ····|··|·|·|||·||||·||||···|||··||||·||·||·|||||·|||||||||| UUUUUUUUUUUUAUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAUAGCCUCAAUAUC... AnchorInformationU Tail Editing Block RNA editing is directed by guide RNAs

17 cox3 mRNA A n edited unedited RNA editing of one mRNA requires several gRNAs

18 p24 p33 p90 p41 p69 p101 p63 p52 p103 p99 p61 p105 p81 p44 p67 p108 p57 p42 p18 p46 hel61 p48 p102 Insertion editing Deletion editing catalytic anchor binding upstream binding EM Editosome Model

19 RNA editing The core machinery: the 20 S editosome Stuart et al., Trends Genet. 2005

20 Crystal structure of the MRP1/MRP2 complex Ribbon diagram with MRP1 in red (subunits A and C) and MRP2 in cyan (subunits B and D) Schumacher et al., Cell 2006

21 The GAP proteins are localized in punctuate loci along the reticulated mitochondrion Immunolocalization using anti-GAP1 antibody Immunolocalization of the HA 3 -tagged versions of GAP1 and GAP2 Hashimi et al., RNA, 2009

22 Kinetoplast DNA network of trypanosomatids

23 Gradual loss of kinetoplast DNA Without kDNA they cannot survive in tse-tse fly but can in mammals (after some compensatory mutations)

24 Figure 5 Editosome and accessory proteins are present even in trypanosomes that have completely lost their mitochondrial DNA (+ RNA) Trypanosoma brucei with kDNA Trypanosoma evansi without kDNA (akinetoplastic; “petite mutant”) Lai et al., PNAS, 2008

25


Download ppt "Trypanosomy v lidské krvi. Euglenozoans are unicellular flagellates that include free-living, commensalic and parasitic species Euglenids DiplonemidsKinetoplastids."

Similar presentations


Ads by Google