Presentation is loading. Please wait.

Presentation is loading. Please wait.

Brad Porter Lecture: Introduction to PCR & Analysis of Gene Expression Using RT-PCR Fri, June 15, 2007 11:00 – 11:50 AM.

Similar presentations


Presentation on theme: "Brad Porter Lecture: Introduction to PCR & Analysis of Gene Expression Using RT-PCR Fri, June 15, 2007 11:00 – 11:50 AM."— Presentation transcript:

1 Brad Porter Lecture: Introduction to PCR & Analysis of Gene Expression Using RT-PCR Fri, June 15, :00 – 11:50 AM

2 Briefly, what is PCR?

3 Polymerase Chain Reaction DNA Denatures at 94°C Primers anneal to single stranded DNA ~55°C Thermostable TAQ polymerase extends primers at ~72°C 5’ 3’ 5’ 3’ Target DNA is doubled. Cycle is then repeated. Target DNA

4 How was PCR discovered?

5 PCR originates from DNA sequencing. So, lets first review DNA sequencing.

6 Primer 3’ 5’ 3’ Primer Anneals & DNA Polymerase Adds Deoxynucleoside triphosphates 37°C Extension New DNA strand is created Sequencing is performed by DNA replication

7 ATGCATGCATGC???????????????????????????????????? 3’ 5’ TACGTACGTACG ATGCATGCATGC???????????????????????????????????? 3’ 5’ Primer 3’ DNA Pol. TACGTACGTACG???????????????????????????????? ATGCATGCATGC???????????????????????????????????? 3’ 5’ Primer 3’ DNA Pol. dNTPs (or bases) are being added, but we do not know the sequence.

8 What if DNA extension could be terminated at a known nucleotide using a mixture of normal bases and termination bases TACGTACGTACGTGT ATGCATGCATGC???????????????????????????????????? 3’ 5’ Primer DNA Pol. A TACGTACGTACGTGT CG ATGCATGCATGC???????????????????????????????????? 3’ 5’ Primer A DNA Pol. A Normal base gets incorporated By probability termination will occur at every “A”

9 dATP dGTP dCTP dTTP+ dATP dGTP dCTP+ dTTP dATP dGTP+ dCTP dTTP dATP+ dGTP dCTP dTTP A T G C DNA What if four reactions were set up to stop at each nucleotide?

10 TACGTACGTACG ATGCATGCATGC???????????????????????????????????? 3’ 5’ Primer DNA Pol. T TACGTACGTACG G ATGCATGCATGC???????????????????????????????????? 3’ 5’ Primer T DNA Pol. T Normal base gets incorporated

11 TACGTACGTACGT ATGCATGCATGC???????????????????????????????????? 3’ 5’ Primer DNA Pol. G TACGTACGTACGT TAC ATGCATGCATGC???????????????????????????????????? 3’ 5’ Primer G DNA Pol. G Normal base gets incorporated

12 TACGTACGTACGTGTA ATGCATGCATGC???????????????????????????????????? 3’ 5’ Primer DNA Pol. C

13 A TACGTACGTACG??? 5’ TACGTACGTACG?????? 5’ A TACGTACGTACG??????? 5’ TACGTACGTACG????? 5’ G GTACGTACGTACG? 5’ TACGTACGTACG??????? 5’ C TACGTACGTACG???? 5’ TACGTACGTACG??????? 5’ TACGTACGTACG?? 5’ T T TACGTACGTACG 5’ TACGTACGTACG??????? 5’

14 A TACGTACGTACG??? 5’ TACGTACGTACG?????? 5’ A TACGTACGTACG????? 5’ G GTACGTACGTACG? 5’ TACGTACGTACG?? 5’ T T TACGTACGTACG 5’ C TACGTACGTACG???? 5’ TACGTACGTACG??????? 5’ 3’ Chain-termination provides sequence!

15 dATP dGTP dCTP dTTP+ ddTTP dATP dGTP dCTP+ ddCTP dTTP dATP dGTP + ddGTP dCTP dTTP dATP + ddATP dGTP dCTP dTTP What causes chain termination? Dideoxynucleoside TriphosphatesDideoxynucleoside Triphosphates

16 Deoxynucleoside triphosphates Deoxy adenosine triphosphate (dATP) Deoxy guanosine triphosphate (dGTP) Deoxy thymidine triphosphate (dTTP) Deoxy cytidine triphosphate (dCTP) Chain Termination 3’ 5’ DNA Polymerase Lacks a 3’ hydroxyl group. Acts as a terminator because, once incorporated, no other nucelotide can be added. X 3’ 5’ DNA Polymerase Dideoxynucleoside triphosphates Dideoxy adenosine triphosphate (ddATP) Dideoxy guanosine triphosphate (ddGTP) Dideoxy thymidine triphosphate (ddTTP) Dideoxy cytidine triphosphate (ddCTP) Chain Extension

17 PhD 1943 Cambridge University Nobel Prize In Chemistry 1958 Amino acid sequence of insulin Nobel Prize In Chemistry 1980 Sequenced the first genome, phage Φ-X174, by hand using a method that he developed. Frederick Sanger The Sanger Dideoxy sequencing method was the foundation for the discovery of PCR.

18 Dideoxy sequencing, one more time.

19 Ok, but what is the connection between DNA sequencing and PCR?

20 1983 Emeryville, California Cetus Corporation Henry Erlich was working on methods for detecting point mutations. 5’-TACGTACGTACGA * GGAGTCCGGAATG-3’ A? T? G? C?

21 Why not do Sanger sequencing at a single base pair? Kary B. Mullis 5’-TACGTACGTACGA * GGAGTCCGGAATG-3’ CCTCAGGCCTTAC-5’ + ddTTP ddCTP ddGTP ddATP

22 First step to a Nobel Prize: As you think, ignore obvious problems.

23 Kary wanted to use total genomic DNA, but he forgot the primer would likely mis-pair and ruin his experiment. In “misguided puttering”, Kary kept thinking! CCTCAGGCCTTAC-5’

24 Kary and girlfriend chemist Jennifer Barnett Mendocino County

25 What if I use two primers for confirmation? + ddTTP ddCTP ddGTP ddATP 3’-ATGCATGCATGCT * CCTCAGGCCTTAC-5’ 5’-GAATTCTACGTACGTACGA F-long 5’-TACGTACGTACGA * GGAGTCCGGAATG-3’ CCTCAGGCCTTAC-5’ R-short

26 + ddTTP ddCTP ddGTP ddATP 3’-ATGCATGCATGCTACCTCAGGCCTTAC-5’ 5’-GAATTCTACGTACGTACGAT F-long 5’-TACGTACGTACGATGGAGTCCGGAATG-3’ ACCTCAGGCCTTAC-5’ R-short F-long R-short

27 What about stray nucleotide triphosphates? + ddTTP ddCTP ddGTP ddATP 3’-ATGCATGCATGCT * CCTCAGGCCTTAC-5’ 5’-GAATTCTACGTACGTACGA F-long 5’-TACGTACGTACGA * GGAGTCCGGAATG-3’ CCTCAGGCCTTAC-5’ R-short dNTP

28 I can destroy stray dNTPs with alkaline phosphatase! But, bacterial alkaline phosphatase will remain because it cannot be heat killed. It will destroy the ddNTP’s (not true).

29 Second step to a Nobel Prize: Make up problems that do not exist and try to solve them.

30 I can deplete nucleotides by adding polymerase first without ddNTP’s 3’-ATGCATGCATGCT * CCTCAGGCCTTAC-5’ 5’-GAATTCTACGTACGTACGA F-long 5’-TACGTACGTACGA * GGAGTCCGGAATG-3’ CCTCAGGCCTTAC-5’ R-short dNTP

31 Denature and anneal primers Polymerase extension DNA replicated! Anderson Valley Third step to a Nobel Prize. Recognize PCR when you find it. 1 Copy 2 Copies!

32 NOBEL PRIZE! …..not so fast

33 Final step to a Nobel Prize: Try to get someone to listen to you.

34 “…no one was particularly enthusiastic about it.” 1984 annual Cetus Scientific Meeting…..”nobody seemed to be interested in my poster….” “People would glance at it and keep walking.” At first, people did not get it. Then Joshua Lederberg (also a Nobel Laureate) said: “Why didn’t I think of that?”

35 1993 Nobel Prize

36 So, how is PCR important to your life, right now? Many SNP’s are associated with disease. Do you have a risk allele?

37 Let’s set up a PCR reaction and find out!

38 Loci for Type 2 Diabetes and Triglyceride Levels GCAGCTCACCTCCAGCTTTAGTTTTC[C/T]CATGACAGTAAGTCTATTACCCTCC Risk allele

39 First, you need to select primers for PCR No, you do not need a computer program to select primers. I prefer 24 bp long and end on G or C Others prefer 20 bp long and end on A or T Try to have at least 50% G’s +C’s to ensure reasonable annealing temperature That’s about it. Do not waste too much time selecting primers.

40 Forward Primer Selection TAAATTCTTTGGAACAGGGGCATGGATTATAAAAGATGTAAGATAATAAAAAGCATTTGTATTTGACT TTGGAATGTATTGTACTTACATTTGTCTAGAGGTGTGTCTATTCTGGCTATTCTCTTTAAAGGAGCCA TTCTATCGTGAACAGATCCTGTTGGAGCTGTTTTCTTGTTCTACCAACCTTCAGCCACCTCTCTGTCT TTCATATTACTTATTGGCAGGGTTTCAAAAGGTTTTAGTCCTTACTTAATATAAACAAAAATGTACAA TATTGACAAAGTTTCAGTTAAGCAGATGAAATTCTAAGAGTTAAGCTGGGATTTTCCAAAATAATCCT GTTAACAGACTTGAAAGCACTTATCAGTTCTGTCTAATGAAGACATTAGAACACCATAACCTTTCCGG CCCATTTTCTTTGTCAATAAGCGTTCTTGCCCTGTCAGCAGCTCACCTCCAGCTTTAGTTTTC X CATG ACAGTAAGTCTATTACCCTCCTGATCTGTCTTCTGGCTCCTCCTACCCAGGATGGGGAAGGTTTTTGA CTTTACTGATATTCTCAGAACAAATTTTGGGAAGTAAATATAAGGTTTTCCAGTCGGGTGCAGTGGCT CACGCCTATGATCCCAGCGCTTTGGGAAACCAAGGTGGGTGGATCACCTGAGGTCAGGAGTTTGAGAC CAGCTTGGCCAATAAGGTGAAACCCCATCTCTACAAAAATTAGTTGGGCGTGGTGGCGGCACCTGTAA ATCCAGCTACTCAGGAGGCTGAGGCAAGAGGATTGCTTGAATCTGGGAGCCGGAGGTTGAAGTGAACT GAGATTGGGCCACTGCATTCTAGCCTGGGCGACAAGAGTGAAGCTCCATCTCAAAAAAAAAAAAAAAG ATGAGGTTTTCCTTAAGAGCACTAACCTAGTATACTGCACAGGTGCCTGTATTCATGCATCCCACACA GAAAGAGAAAATACTTGTCTGAACTTGTCCATAAATTCAGAATCCTGCCCCTTAAC Forward Primer: 5’-AGAACACCATAACCTTTCCGGCCC-3’

41 TAAATTCTTTGGAACAGGGGCATGGATTATAAAAGATGTAAGATAATAAAAAGCATTTGTATTTGACT TTGGAATGTATTGTACTTACATTTGTCTAGAGGTGTGTCTATTCTGGCTATTCTCTTTAAAGGAGCCA TTCTATCGTGAACAGATCCTGTTGGAGCTGTTTTCTTGTTCTACCAACCTTCAGCCACCTCTCTGTCT TTCATATTACTTATTGGCAGGGTTTCAAAAGGTTTTAGTCCTTACTTAATATAAACAAAAATGTACAA TATTGACAAAGTTTCAGTTAAGCAGATGAAATTCTAAGAGTTAAGCTGGGATTTTCCAAAATAATCCT GTTAACAGACTTGAAAGCACTTATCAGTTCTGTCTAATGAAGACATTAGAACACCATAACCTTTCCGG CCCATTTTCTTTGTCAATAAGCGTTCTTGCCCTGTCAGCAGCTCACCTCCAGCTTTAGTTTTC X CATG ACAGTAAGTCTATTACCCTCCTGATCTGTCTTCTGGCTCCTCCTACCCAGGATGGGGAAGGTTTTTGA CTTTACTGATATTCTCAGAACAAATTTTGGGAAGTAAATATAAGGTTTTCCAGTCGGGTGCAGTGGCT CACGCCTATGATCCCAGCGCTTTGGGAAACCAAGGTGGGTGGATCACCTGAGGTCAGGAGTTTGAGAC CAGCTTGGCCAATAAGGTGAAACCCCATCTCTACAAAAATTAGTTGGGCGTGGTGGCGGCACCTGTAA ATCCAGCTACTCAGGAGGCTGAGGCAAGAGGATTGCTTGAATCTGGGAGCCGGAGGTTGAAGTGAACT GAGATTGGGCCACTGCATTCTAGCCTGGGCGACAAGAGTGAAGCTCCATCTCAAAAAAAAAAAAAAAG ATGAGGTTTTCCTTAAGAGCACTAACCTAGTATACTGCACAGGTGCCTGTATTCATGCATCCCACACA GAAAGAGAAAATACTTGTCTGAACTTGTCCATAAATTCAGAATCCTGCCCCTTAAC Reverse Primer Selection Reverse Primer: 5’-GCGTGAGCCACTGCACCCGACTGG-3’

42 AGAACACCATAACCTTTCCGGCCCATTTTCTTTGTCAATAAGCGTTCTTGCCCTG TCAGCAGCTCACCTCCAGCTTTAGTTTTCXCATGACAGTAAGTCTATTACCCTCC TGATCTGTCTTCTGGCTCCTCCTACCCAGGATGGGGAAGGTTTTTGACTTTACTG ATATTCTCAGAACAAATTTTGGGAAGTAAATATAAGGTTTTCCAGTCGGGTGCAG TGGCTCACGC Amplified Fragment Will Be 230bp

43 Forward Primer: 5’-AGAACACCATAACCTTTCCGGCCC-3’ Reverse Primer: 5’-GCGTGAGCCACTGCACCCGACTGG-3’

44 TAAATTCTTTGGAACAGGGGCATGGATTATAAAAGATGTAAGATAATAAAAAGCATTTGTATTTGACT TTGGAATGTATTGTACTTACATTTGTCTAGAGGTGTGTCTATTCTGGCTATTCTCTTTAAAGGAGCCA TTCTATCGTGAACAGATCCTGTTGGAGCTGTTTTCTTGTTCTACCAACCTTCAGCCACCTCTCTGTCT TTCATATTACTTATTGGCAGGGTTTCAAAAGGTTTTAGTCCTTACTTAATATAAACAAAAATGTACAA TATTGACAAAGTTTCAGTTAAGCAGATGAAATTCTAAGAGTTAAGCTGGGATTTTCCAAAATAATCCT GTTAACAGACTTGAAAGCACTTATCAGTTCTGTCTAATGAAGACATTAGAACACCATAACCTTTCCGG CCCATTTTCTTTGTCAATAAGCGTTCTTGCCCTGTCAGCAGCTCACCTCCAGCTTTAGTTTTC X CATG ACAGTAAGTCTATTACCCTCCTGATCTGTCTTCTGGCTCCTCCTACCCAGGATGGGGAAGGTTTTTGA CTTTACTGATATTCTCAGAACAAATTTTGGGAAGTAAATATAAGGTTTTCCAGTCGGGTGCAGTGGCT CACGCCTATGATCCCAGCGCTTTGGGAAACCAAGGTGGGTGGATCACCTGAGGTCAGGAGTTTGAGAC CAGCTTGGCCAATAAGGTGAAACCCCATCTCTACAAAAATTAGTTGGGCGTGGTGGCGGCACCTGTAA ATCCAGCTACTCAGGAGGCTGAGGCAAGAGGATTGCTTGAATCTGGGAGCCGGAGGTTGAAGTGAACT GAGATTGGGCCACTGCATTCTAGCCTGGGCGACAAGAGTGAAGCTCCATCTCAAAAAAAAAAAAAAAG ATGAGGTTTTCCTTAAGAGCACTAACCTAGTATACTGCACAGGTGCCTGTATTCATGCATCCCACACA GAAAGAGAAAATACTTGTCTGAACTTGTCCATAAATTCAGAATCCTGCCCCTTAAC 5’-AGAACACCATAACCTTTCCGG CCC-3’  Forward Primer: 5’-AGAACACCATAACCTTTCCGGCCC-3’ Before ordering: Imagine the primers annealing to the DNA Reverse Primer: 5’-GCGTGAGCCACTGCACCCGACTGG-3’ AGCCACTGCACCCGACTGG-3’  Reverse Primer: 5’-GCGTG

45 Order From IDT Forward Primer: 5’-AGAACACCATAACCTTTCCGGCCC-3’ Reverse Primer: 5’-GCGTGAGCCACTGCACCCGACTGG-3’

46 Start Finish H μl 10XPCR Buffer5.0 μl 25mM MgCl μl 4mM dNTP’s2.5 μl 10pmol Forward Primer 5.0 μl (10pmol) 10pmol Reverse Primer 5.0 μl (10pmol) Template DNA>10 4 copies of target sequence (1.0 μl) TAQ Polymerase0.25 μl (5u/μl) PCR Components

47 Use thin-wall PCR tubes Use thin-wall tubes designed for PCR

48 Old School “Perkin Elmer 2400” PCR Thermocycler Hot bonnet prevents condensation.

49 Mineral Oil Sample If your thermocycler does not have a hot bonnet or if you will need to open the hot bonnet to remove or modify a reaction, use mineral oil.

50 Runs on antifreeze and refrigerant Paper towels to adsorb leaking orange-colored antifreeze.

51 Antifreeze

52 R134a frigerant

53 Radiator & fan

54 New Thermocyclers = Peltier Cooling & Gradient Blocks Peltier effect It occurs when a current is passed through two dissimilar metals or semiconductors (n-type and p- type) that are connected to each other at two junctions (Peltier junctions). The current drives a transfer of heat from one junction to the other: one junction cools off while the other heats up; as a result, the effect is often used for thermoelectric cooling. This effect was observed in 1834 by Jean Peltier.

55 A typical PCR thermocycling program

56 55°C 62°C 61°C 60°C 59°C 58°C 57°C 56°C Gradient thermocyclers allow for optimization of the annealing temperature

57 What is RT-PCR? Reverse Transcription- Polymerase Chain Reaction

58 RT-PCR is like any other PCR except it uses cDNA as a template.

59 How do you make cDNA? cDNA can be created from RNA using RNA-dependent DNA polymerase (reverse transcriptase)

60 How do you make cDNA? mRNA AAAAAAAAAAAA 5’- -3’ TTTTTTTTTTTT -5’ mRNA AAAAAAAAAAAA 5’- -3’ TTTTTTTTTTTT -5’ cDNA Reverse transcriptase Oligo (dT) Primer Template For PCR 3’-

61 RT-PCR measures the presence of cDNA corresponding to its respective RNA. RT-PCR is, therefore, used to indirectly estimate RNA abundance which MAY indicate the level of gene expression.

62 Major Points Sequencing and PCR both use DNA polymerase and replicate DNA (PCR uses TAQ DNA polymerase). Kary Mullis discovered PCR while thinking about a possible dideoxy sequencing experiment. Half of a Nobel discovery is finding it, the other half is realizing what you have found. RT-PCR is used to estimate gene expression


Download ppt "Brad Porter Lecture: Introduction to PCR & Analysis of Gene Expression Using RT-PCR Fri, June 15, 2007 11:00 – 11:50 AM."

Similar presentations


Ads by Google