Presentation is loading. Please wait.

Presentation is loading. Please wait.

DNA Sequencing and Identification of Encoded Genes Kimberley Chinen June 30, 2006 ABE Workshop.

Similar presentations


Presentation on theme: "DNA Sequencing and Identification of Encoded Genes Kimberley Chinen June 30, 2006 ABE Workshop."— Presentation transcript:

1 DNA Sequencing and Identification of Encoded Genes Kimberley Chinen June 30, 2006 ABE Workshop

2 Purpose To determine the order of nucleotides in a segment of DNA To verify the identity of the encoded gene –PDI2 –GFP

3 Template Preparation Isolation of Total RNA from Arabidopsis thaliana  Grind and lyse Arabidopsis leaves  Adsorption of total RNA to silica membrane  Removal of contaminants  Quantify RNA

4 RT-PCR Reverse Transcription mRNAdsDNA DNA transcript of RNA DNA-RNA hybrid

5 RT-PCR

6 Group 2 RT PCR Result 100b + WT 2SC GFP5er –RT H2O P+ 100bp + WT 2A1 2A2 –RT H2O P+ Group 1 RT PCR Result

7 Group 4 RT PCR Result 100bp + WT 2A1 2A2 –RT H2O P+ Group 3 RT PCR Result 100b + WT 2SC GFP5er –RT H2O P+

8 MW Hen pdi2 p H pBIN GFP Tu Tu pdi2 BIN 35S pla 1 6 Gr 1 Gr2 Gr3 Gr4 Gel Purified RT_PCR products for use as inserts in TOPO cloning reactions RT-PCR Results

9 Molecular Cloning

10 Ligate RT-PCR product into pCR4-TOPO cloning vector Transform E. coli bacteria by heat shock Amplify and select transformed bacteria using ampicillin treated plates Isolate plasmid DNA Run agarose gel electrophoresis Extract and purify DNA

11 DNA SEQUENCING 1.PCR 2.DNA Sequencing in polyacrylamide gel

12 DNA Samples Sent in for Sequencing Tube #PrimerGeneSourceGroup 1T3PDI2 Pos Control1 2T7PDI2 3T3GFP 2 4T7GFP 5T3PDI2 6T7PDI2 7T3PDI2 Henry's Control 3 8T7PDI2 9T3PDI2 Pos Control 10T7PDI2 11T3PDI2 Pos Control 4 12T7PDI2 13T3PDI2 Henry's Control 14T7PDI2

13 1.PCR – 4.5 hours We Provided DNA Template T3 or T7 Primer They added dideoxynucleotides – fluorescently labeled DNA polymerase

14 T3 and T7 Priming Sites

15 Deoxynucleotides vs. Dideoxynucleotides

16 2. DNA Sequencing of PCR Products in Polyacrylamide Gel PCR products are loaded and run in a polyacrylamide gel to separate the fragments by length in an automated DNA sequencer. A scanner in the sequencer detects the fluorescence and order of the separate bands.

17 GREENWOOD MOLECULAR BIOLOGY FACILITY Applied Biosystems 377XL DNA Sequencer at UHM’s

18 GREENWOOD MOLECULAR BIOLOGY FACILITY AT UHM

19 Chromatogram from ChromasPro

20 Tube 7 Results GTCGCAGTTTAACGAATTCGCCCTTACACCATGGTGCGTAGACCTCGAGAAGCACATCTT TAGAATCGTCCAGAACAATTTCATCAAAGTTATCTCCAACCACTATTTTCACATCTTCAT CGTTCTTTTCAGGAATGGGGTCTGACTTATAGAAAGGCTTTAACTTGTCGTTCAGGAAAT CCTCCCCAAATATCTTAATTTTATCTGACTGGATCTCGCCATCGAAAAAGTATTTTTTAG GGTCTTCATTCCCTGTGTAGCCAATAAGTTTAGGACCATTTCCAGACACACCAAAGTATT CAGCGACTGGCTTCCCATAATCCTCATTATCCAGATCCACAGATACAAAGATGAGCTTTC CTTTGAATGATTTCGCTGCTTCTTGAAATTCCGTAAGAACCTTTTCAGATTCATTTTTGG TTACAAACAACAACAACTGTTTCTTGATTGCACTCTCAAAAATTTCCGGAGCAGTCTCTC TGGTGAAAACAGAGACCAAAGCAAGCTTGTTGGCAGACACAAAACTAACTAGAGCAGACT TAACAAATTCTCCATCAAAATGGCTAATTTTCTCCTCTTCCTTCTTAACTAGGACAAGAG CANGCCTTTTAGACTCCGGATCAAGGTGAAACATCTTTGCAACATCAGGATTCACTGTTT GATAAAAGTTCACATCGTCTTCAGCTTTGGAAGCAGCATTNAGCTGATCGTGCTCAACAC CCACCAAGGAGTTCAAGTATCCCAAAACNACTTTGTTCCCAGAAGTCAACACTTTCTCAG CATCATCTAANGNAGTTAGATTATACACCCAGGGACCAATCTTCTTTTTNCCCATGGCAC AATTGGTTCTTTAGNCCTTCCCCCCGGGAAGGGNTGGGGCCCCCCTCACCCAAAAAAAAA ACNTCNGAAAACCCTGAANACNAAACTCCCGGANTAANTCNTTTTCCCCCGCCCANCAAT TTTANCCAAAAAAAACCCTNTTTCTTAANTCCCTGGGNAAAGGGGNAATTCCGGCNCCTA AATTAANTTN

21 Cut at the beginning of PCR Product for T3 Primed Sequences

22 Cut off left and right sequences Tube 7 Right Left Cut Off ACACCATGGTGCGTAGACCTCGAGAAGCACATCTTTAGAATCGTCCAGAACAATTTCATC AAAGTTATCTCCAACCACTATTTTCACATCTTCATCGTTCTTTTCAGGAATGGGGTCTGA CTTATAGAAAGGCTTTAACTTGTCGTTCAGGAAATCCTCCCCAAATATCTTAATTTTATC TGACTGGATCTCGCCATCGAAAAAGTATTTTTTAGGGTCTTCATTCCCTGTGTAGCCAAT AAGTTTAGGACCATTTCCAGACACACCAAAGTATTCAGCGACTGGCTTCCCATAATCCTC ATTATCCAGATCCACAGATACAAAGATGAGCTTTCCTTTGAATGATTTCGCTGCTTCTTG AAATTCCGTAAGAACCTTTTCAGATTCATTTTTGGTTACAAACAACAACAACTGTTTCTT GATTGCACTCTCAAAAATTTCCGGAGCAGTCTCTCTGGTGAAAACAGAGACCAAAGCAAG CTTGTTGGCAGACACAAAACTAACTAGAGCAGACTTAACAAATTCTCCATCAAAATGGCT AATTTTCTCCTCTTCCTTCTTAACTAGGACAAGAGCANGCCTTTTAGACTCCGGATCAAG GTGAAACATCTTTGCAACATCAGGATTCACTGTTTGATAAAAGTTCACATCGTCTTCAGC TTTGGAAGCAGCATTNAGCTGATCGTGCT

23 ATNGATTAGCGGCCGCGAATTCGCCCTTGCCACGGAGCTTAAGGAAGATGGTGTTGTTTT GGCTAAGATTGATGCGACGGAGGAGAATGAGTTAGCTCAGGAGTATCGTGTTCAGGGCTT TCCGACGCTTCTTTTCTTCGTTGATGGTGAGCACAAGCCTTACACTGGAGGAAGGACTAA AGAAACAATTGTGACATGGGTGAAGAANAAGATTGGTCCTGGTGTGTATAATCTAACTAC ATTAGATGATGCTGAGAAAGTGTTGACTTCTGGGAACAAAGTTGTTTTGGGATACTTGAA CTCCTTGGTGGGTGTTGAGCACGATCAGCTTAATGCTGCTTCCAAAGCTGAAGACGATGT GAACTTTTATCAAACAGTGAATCCTGATGTTGCAAAGATGTTTCACCTTGATCCGGAGTC TAAAAGGCCTGCTCTTGTCCTAGTTAAGAAGGAAGAGGAGAAAATTAGCCATTTTGATGG AGAATTTGTTAAGTCTGCTCTAGTTAGTTTTGTGTCTGCCAACAAGCTTGCTTTGGTCTC TGTTTTCCCAGAAAGACTGCTCCGGAAATTTTTGAGAGTGCAATCAAGAAACAGTTGTTG TTGTTTGTAACCAAAAATGAATCTGAAAANGTTCTTACNGAATTTCAAGAAGCAGCGAAA TCATTCAAAGGAAAGCTCATCTTTTGTATCTGTGGATCTGGATAATGANGATTATNGGGA AGCCNGTCCCCTGAAAACCTTTGGGGGTGTCCTGGNAATGGGCCCNAAAACTTATTGGGC TACCCCNGGGGNAATGAAAAAACCCTAAAAAAANACCTTTTTTCCAATGGGGGAAAATNC CCNTCCCNAANAAAAAATTAAAAANANTTTNGGGGAAGGAATTTCCCGGAAACAACAAAG TTNAAANCCCNTTNTNTAAATCCNAAANCCCCNTTCCCTGAAAAAAAACCNATCANAAAT NTTGNAAAAAAANGGGTTGGGANAAAAANTTTTAAANAAAATTNNTTCTGGGAANAATTT TAAAAAATGGCNTTTCCCNGGGCCTNCCCCCCCCGGGGGGAANGGGGGAAATTTNTTTAA ACN Tube 8 Results

24 Reverse Complement

25 Tube 8 Reverse Complement NGTTTAAANAAATTTCCCCCNTTCCCCCCGGGGGGGGNAGGCCCNGGGAAANGCCATTTT TTAAAATTNTTCCCAGAANNAATTTTNTTTAAAANTTTTTNTCCCAACCCNTTTTTTTNC AANATTTNTGATNGGTTTTTTTTCAGGGAANGGGGNTTTNGGATTTANANAANGGGNTTT NAACTTTGTTGTTTCCGGGAAATTCCTTCCCCNAAANTNTTTTTAATTTTTTNTTNGGGA NGGGNATTTTCCCCCATTGGAAAAAAGGTNTTTTTTTAGGGTTTTTTCATTNCCCCNGGG GTAGCCCAATAAGTTTTNGGGCCCATTNCCAGGACACCCCCAAAGGTTTTCAGGGGACNG GCTTCCCNATAATCNTCATTATCCAGATCCACAGATACAAAAGATGAGCTTTCCTTTGAA TGATTTCGCTGCTTCTTGAAATTCNGTAAGAACNTTTTCAGATTCATTTTTGGTTACAAA CAACAACAACTGTTTCTTGATTGCACTCTCAAAAATTTCCGGAGCAGTCTTTCTGGGAAA ACAGAGACCAAAGCAAGCTTGTTGGCAGACACAAAACTAACTAGAGCAGACTTAACAAAT TCTCCATCAAAATGGCTAATTTTCTCCTCTTCCTTCTTAACTAGGACAAGAGCAGGCCTT TTAGACTCCGGATCAAGGTGAAACATCTTTGCAACATCAGGATTCACTGTTTGATAAAAG TTCACATCGTCTTCAGCTTTGGAAGCAGCATTAAGCTGATCGTGCTCAACACCCACCAAG GAGTTCAAGTATCCCAAAACAACTTTGTTCCCAGAAGTCAACACTTTCTCAGCATCATCT AATGTAGTTAGATTATACACACCAGGACCAATCTTNTTCTTCACCCATGTCACAATTGTT TCTTTAGTCCTTCCTCCAGTGTAAGGCTTGTGCTCACCATCAACGAAGAAAAGAAGCGTC GGAAAGCCCTGAACACGATACTCCTGAGCTAACTCATTCTCCTCCGTCGCATCAATCTTA GCCAAAACAACACCATCTTCCTTAAGCTCCGTGGCAAGGGCGAATTCGCGGCCGCTAATC NAT

26 Cut at the end of PCR Product for T7 Primed Sequences

27 Cut at the ends of PCR Product for T7 Primed Sequences Example: Tube 8 Reverse Complement with right and left ends cut TATCCAGATCCACAGATACAAAAGATGAGCTTTCCTTTGAATGATTTCGCTGCTTCTTGA AATTCNGTAAGAACNTTTTCAGATTCATTTTTGGTTACAAACAACAACAACTGTTTCTTG ATTGCACTCTCAAAAATTTCCGGAGCAGTCTTTCTGGGAAAACAGAGACCAAAGCAAGCT TGTTGGCAGACACAAAACTAACTAGAGCAGACTTAACAAATTCTCCATCAAAATGGCTAA TTTTCTCCTCTTCCTTCTTAACTAGGACAAGAGCAGGCCTTTTAGACTCCGGATCAAGGT GAAACATCTTTGCAACATCAGGATTCACTGTTTGATAAAAGTTCACATCGTCTTCAGCTT TGGAAGCAGCATTAAGCTGATCGTGCTCAACACCCACCAAGGAGTTCAAGTATCCCAAAA CAACTTTGTTCCCAGAAGTCAACACTTTCTCAGCATCATCTAATGTAGTTAGATTATACA CACCAGGACCAATCTTNTTCTTCACCCATGTCACAATTGTTTCTTTAGTCCTTCCTCCAG TGTAAGGCTTGTGCTCACCATCAACGAAGAAAAGAAGCGTCGGAAAGCCCTGAACACGAT ACTCCTGAGCTAACTCATTCTCCTCCGTCGCATCAATCTTAGCCAAAACAACACCATCTT CCTTAAGCTCCGTGGCA

28 Finding where the sequences overlap

29 Tube 7 ACACCATGGTGCGTAGACCTCGAGAAGCACATCTTTAGAATCGTCCAGAACAATTTCATC AAAGTTATCTCCAACCACTATTTTCACATCTTCATCGTTCTTTTCAGGAATGGGGTCTGA CTTATAGAAAGGCTTTAACTTGTCGTTCAGGAAATCCTCCCCAAATATCTTAATTTTATC TGACTGGATCTCGCCATCGAAAAAGTATTTTTTAGGGTCTTCATTCCCTGTGTAGCCAAT AAGTTTAGGACCATTTCCAGACACACCAAAGTATTCAGCGACTGGCTTCCCATAATCCTC ATTATCCAGATCCACAGATACAAAGATGAGCTTTCCTTTGAATGATTTCGCTGCTTCTTG AAATTCCGTAAGAACCTTTTCAGATTCATTTTTGGTTACAAACAACAACAACTGTTTCTT GATTGCACTCTCAAAAATTTCCGGAGCAGTCTCTCTGGTGAAAACAGAGACCAAAGCAAG CTTGTTGGCAGACACAAAACTAACTAGAGCAGACTTAACAAATTCTCCATCAAAATGGCT AATTTTCTCCTCTTCCTTCTTAACTAGGACAAGAGCANGCCTTTTAGACTCCGGATCAAG GTGAAACATCTTTGCAACATCAGGATTCACTGTTTGATAAAAGTTCACATCGTCTTCAGC TTTGGAAGCAGCATTNAGCTGATCGTGCT Tube 8 TATCCAGATCCACAGATACAAAAGATGAGCTTTCCTTTGAATGATTTCGCTGCTTCTTGA AATTCNGTAAGAACNTTTTCAGATTCATTTTTGGTTACAAACAACAACAACTGTTTCTTG ATTGCACTCTCAAAAATTTCCGGAGCAGTCTTTCTGGGAAAACAGAGACCAAAGCAAGCT TGTTGGCAGACACAAAACTAACTAGAGCAGACTTAACAAATTCTCCATCAAAATGGCTAA TTTTCTCCTCTTCCTTCTTAACTAGGACAAGAGCAGGCCTTTTAGACTCCGGATCAAGGT GAAACATCTTTGCAACATCAGGATTCACTGTTTGATAAAAGTTCACATCGTCTTCAGCTT TGGAAGCAGCATTAAGCTGATCGTGCTCAACACCCACCAAGGAGTTCAAGTATCCCAAAA CAACTTTGTTCCCAGAAGTCAACACTTTCTCAGCATCATCTAATGTAGTTAGATTATACA CACCAGGACCAATCTTNTTCTTCACCCATGTCACAATTGTTTCTTTAGTCCTTCCTCCAG TGTAAGGCTTGTGCTCACCATCAACGAAGAAAAGAAGCGTCGGAAAGCCCTGAACACGAT ACTCCTGAGCTAACTCATTCTCCTCCGTCGCATCAATCTTAGCCAAAACAACACCATCTT CCTTAAGCTCCGTGGCA

30 Putting the Two Partial Sequences Together ACACCATGGTGCGTAGACCTCGAGAAGCACATCTTTAGAATCGTCCAGAACAATTTCATC AAAGTTATCTCCAACCACTATTTTCACATCTTCATCGTTCTTTTCAGGAATGGGGTCTGA CTTATAGAAAGGCTTTAACTTGTCGTTCAGGAAATCCTCCCCAAATATCTTAATTTTATC TGACTGGATCTCGCCATCGAAAAAGTATTTTTTAGGGTCTTCATTCCCTGTGTAGCCAAT AAGTTTAGGACCATTTCCAGACACACCAAAGTATTCAGCGACTGGCTTCCCATAATCCTC ATTATCCAGATCCACAGATACAAAGATGAGCTTTCCTTTGAATGATTTCGCTGCTTCTTGA AATTCNGTAAGAACNTTTTCAGATTCATTTTTGGTTACAAACAACAACAACTGTTTCTTG ATTGCACTCTCAAAAATTTCCGGAGCAGTCTTTCTGGGAAAACAGAGACCAAAGCAAGCT TGTTGGCAGACACAAAACTAACTAGAGCAGACTTAACAAATTCTCCATCAAAATGGCTAA TTTTCTCCTCTTCCTTCTTAACTAGGACAAGAGCAGGCCTTTTAGACTCCGGATCAAGGT GAAACATCTTTGCAACATCAGGATTCACTGTTTGATAAAAGTTCACATCGTCTTCAGCTT TGGAAGCAGCATTAAGCTGATCGTGCTCAACACCCACCAAGGAGTTCAAGTATCCCAAAA CAACTTTGTTCCCAGAAGTCAACACTTTCTCAGCATCATCTAATGTAGTTAGATTATACA CACCAGGACCAATCTTNTTCTTCACCCATGTCACAATTGTTTCTTTAGTCCTTCCTCCAG TGTAAGGCTTGTGCTCACCATCAACGAAGAAAAGAAGCGTCGGAAAGCCCTGAACACGAT ACTCCTGAGCTAACTCATTCTCCTCCGTCGCATCAATCTTAGCCAAAACAACACCATCTT CCTTAAGCTCCGTGGCA

31 BLAST Search for the combined sequence in tubes 7 and 8

32

33 Sequences with Significant Alignments

34 Sequence Alignments

35 Arabidopsis thaliana At5g60640 Gene Information

36 Translation

37 Full Gene Sequence

38 Blast search results for combined sequences from tubes 3 and 4 GFP

39 GFP Sequence Alignment Results

40 Summary Arabidopsis thaliana Total RNA cDNA tDNA DNA Sequencing Identification of Genes –PDI2 –GFP


Download ppt "DNA Sequencing and Identification of Encoded Genes Kimberley Chinen June 30, 2006 ABE Workshop."

Similar presentations


Ads by Google