Presentation is loading. Please wait.

Presentation is loading. Please wait.

RNA Translation. RNA Processing End product is a mature RNA molecule that leaves the nucleus to the cytoplasm. Introns bad…… Exons good! DNA RNA Protein.

Similar presentations


Presentation on theme: "RNA Translation. RNA Processing End product is a mature RNA molecule that leaves the nucleus to the cytoplasm. Introns bad…… Exons good! DNA RNA Protein."— Presentation transcript:

1 RNA Translation

2 RNA Processing End product is a mature RNA molecule that leaves the nucleus to the cytoplasm. Introns bad…… Exons good! DNA RNA Protein TRANSCRIPTION TRANSLATION Introns are pulled out and exons come together.

3 RNA Processing pre-RNA molecule intron exon Mature RNA molecule exon intron splicesome Processing must occur before mRNA can be used to produce a correct protein through translation. the spliceosome catalyzes the reaction RNA Post-Transcriptional

4 A. Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop stopcodon protein AUGGGCUCCAUCGGCGCAUAA mRNA start startcodon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2 codon 3 codon 4 codon 5 codon 6 codon 7 codon 1 RNA Translation

5 UCAG U C A G G A C U G A C U G A C U G A C U UUUUUU UUCUUC UUAUUA UUGUUG CUUCUU CUCCUC CUACUA CUGCUG AUUAUU AUCAUC AUAAUA AUGAUG GUUGUU GUCGUC GUAGUA GUGGUG phe leu ile met (start) val UCUUCU UCCUCC UCAUCA UCGUCG CCUCCU CCCCCC CCACCA CCGCCG ACUACU ACCACC ACAACA ACGACG GCUGCU GCCGCC GCAGCA GCGGCG ser pro thr ala UAUUAU UACUAC UAAUAA UAGUAG CAUCAU CACCAC CAACAA CAGCAG AAUAAU AACAAC AAGAAG AAAAAA GAUGAU GACGAC GAAGAA GAGGAG tyr stop his gln asn lys asp glu UGUUGU UGCUGC UGAUGA UGGUGG CGUCGU CGCCGC CGACGA CGGCGG AGUAGU AGCAGC AGAAGA AGGAGG GGUGGU GGCGGC GGAGGA GGGGGG cys stop trp arg ser arg gly First Base Third Base Second Base Virtually all organisms share the same genetic code “unity of life”

6 mRNA Carries instructions from DNA to the rest of the ribosome. Tells the ribosome what kind of protein to make Acts like an from the principal to the cafeteria staff. RNA Translation

7 rRNA Part of the structure of a ribosome Helps in protein production tRNA A go-getter. Gets the right parts to make the right protein according to mRNA instructions RNA Translation

8 B. Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid RNA Translation

9 Table 14.2 Types of RNA Type of RNA Functions inFunction Messenger RNA (mRNA) Nucleus, migrates to ribosomes in cytoplasm Carries DNA sequence information to ribosomes Transfer RNA (tRNA) Cytoplasm Provides linkage between mRNA and amino acids; transfers amino acids to ribosomes Ribosomal RNA (rRNA) Cytoplasm Structural component of ribosomes

10 Figure Codon recognition Amino acid Anticodon A site P site Polypeptide 2 Peptide bond formation 3 Translocation New peptide bond mRNA movement mRNA Stop codon

11 An example of translation: Transcription / translation

12 Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

13 Translation - making proteins Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

14 Translation Three parts: initiation 1.initiation: start codon (AUG) elongation 2.elongation: termination 3.termination: stop codon (UAG) PROTEIN!!!! Let’s make a PROTEIN!!!!.

15 Translation P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

16 Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

17 mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

18 mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

19 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

20 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

21 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

22 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

23 mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

24 End Product primary structure of a protein The end products of protein synthesis is a primary structure of a protein. amino acid peptide bonds A sequence of amino acid bonded together by peptide bonds. aa1 aa2 aa3 aa4 aa5 aa200 aa199

25

26 Question: The anticodon UAC belongs to a tRNA that recognizes and binds to a particular amino acid. The anticodon UAC belongs to a tRNA that recognizes and binds to a particular amino acid. What would be the DNA base code for this amino acid? What would be the DNA base code for this amino acid?

27 Answer: tRNA - UAC (anticodon) tRNA - UAC (anticodon) mRNA- AUG (codon) mRNA- AUG (codon) DNA - TAC DNA - TAC

28 Protein Processing Post-translational processing – Proteins undergo many processes such as folding, cutting and other processes), before becoming the mature protein product DNA RNA Protein TRANSCRIPTION TRANSLATION

29 Summarize the steps of translation from your text (pg 257 – 260)

30 An example of translation: Transcription / translation


Download ppt "RNA Translation. RNA Processing End product is a mature RNA molecule that leaves the nucleus to the cytoplasm. Introns bad…… Exons good! DNA RNA Protein."

Similar presentations


Ads by Google