Presentation is loading. Please wait.

Presentation is loading. Please wait.

2014 Open Enrollment Benefits. 2014 Medical Plans 2013 (7 plans)2014 (5 plans) Anthem PPO Anthem PLUS Anthem HRA-PPO UC Care Blue Shield Health Savings.

Similar presentations


Presentation on theme: "2014 Open Enrollment Benefits. 2014 Medical Plans 2013 (7 plans)2014 (5 plans) Anthem PPO Anthem PLUS Anthem HRA-PPO UC Care Blue Shield Health Savings."— Presentation transcript:

1 2014 Open Enrollment Benefits

2 2014 Medical Plans 2013 (7 plans)2014 (5 plans) Anthem PPO Anthem PLUS Anthem HRA-PPO UC Care Blue Shield Health Savings Plan Health Net Blue & Gold HMO Health Net Full Network HMO Kaiser HMO Health Net Blue & Gold HMO Kaiser HMO Core

3 2014 Medical Plans UC Care plan design comparison Anthem PLUSAnthem PPOUC Care Blue Shield In/Out UC Select Deductible In Out None $500/$1,500 $250/$750 $500/$1,500 $250/$750 $500/$1,500 None Out-Of-Pocket Max$5,000/$15,000$3,000/$9,000 $5,000/$15,000 $1,500/$4,500 MD Visits (member share) In Out $25 30% 20% 40% 20% 50% $20 Outpatient (member share) In Out $0 30% 20% 40% 20% 50% $20/20% (depending on service) Hospitalization (member share) In Out $250 30% 20% 40% 20% 50% $250 Rx (member share)$10/30/45 $5/25/40

4 UC Care plan design

5 UC Care network Differences across locations A customized network of UC facilities and other high quality, low cost providers because every campus does not have a UC facility nearby In-network UC Select Blue Shield Preferred BlueCard network coverage outside of CA and the U.S. Out-of-network PPO providers not contracted within UC Select and Blue Shield Preferred

6 UC Care network UC Select All UC medical centers, facilities and physicians Additional select Blue Shield providers in areas where UC medical centers and physicians may not be accessible Chosen based on quality, location, cost and contracts (with Blue Shield) See appendix for facilities in UC Select Blue Shield Preferred Network 376 hospitals 22,061 primary care physicians 50,197 specialists BlueCard Network coverage outside of CA and the U.S. 97% of Anthem contract providers are in the Blue Shield Preferred network 88% of providers in California are in the Blue Shield Preferred network

7 UCLA (1 of 3) UC Select Providers Citrus Valley Medical Center - Queen of the Valley Downey Regional Medical Center Garfield Medical Center (San Gabriel Valley) Glendale Adventist Medical Center Good Samaritan Hospital (Los Angeles) Henry Mayo Newhall Hospital (Santa Clarita Valley) Huntington Memorial Hospital (Pasadena) Northridge Medical Center (Northridge) Providence Little Company of Mary (Torrance) Providence Little Company of Mary Medical Center San Pedro Providence Tarzana Medical Center

8 UCLA (2 of 3) UC Select Providers Simi Valley Adventist Hospital (Dignity) St. Mary Medical Center (Long Beach) Torrance Memorial Medical Center UCLA/Mattel Children's Hospital UCLA/Resnick Neuropsychiatric Hospital UCLA/Ronald Reagan UCLA Medical Center UCLA/Santa Monica UCLA Medical Center White Memorial Medical Center Whittier Hospital Medical Center San Antonio Community Hospital

9 UCLA (3 of 3) Some providers were excluded from UC Select, but are in Blue Shield Preferred: Los Robles Medical Center – excluded due to high cost. Lower cost alternative providers available in the area West Hills Medical Center – excluded due to high cost. Lower cost alternative providers available in the area

10 The Blue Shield Health Savings Plan Mark Esteban, Director Health & Welfare Planning and Financials

11 Blue Shield Health Savings Plan Health Savings Account (HealthEquity) Medical Coverage (Blue Shield PPO) + Combines high deductible PPO with account to pay out-of-pocket expenses

12 Your Health Savings Account:  You own the account  You can contribute to it  It has triple tax advantages  It comes with a HSA Debit Card Currently enrolled in Anthem Lumenos and have an HRA balance? You’ll keep it as long as you enroll in the Health Savings Plan. Why is it better than an HRA?

13 How does the HSA work?  UC funds your HSA account with $500 for individual and $1,000 for family  You can contribute up to $2,800/individual $5,550 family  If you’re 55 or older, you can contribute more  You can’t participate in this plan and UC’s Flexible Spending Account at the same time  You can’t be anyone’s tax dependent

14 Medical PPO Plan Design Medical Plan Coverage *Network preventive care covered at 100% In NetworkOut of Network Deductible* Single Family $1,250 $2,500 $5,000 Out-of-Pocket Max (includes deductible) Single Family $4,000 $6,400 $8,000 $16,000 Member Cost Sharing (coinsurance after deductible is met) 20%40%

15 HSA Funding Contribution TypesIndividualFamily UC Contribution$500$1,000 Employee Pre-Tax (optional) up to $2,800up to $5,550

16 1.Go to your doctor. 2.Later – check your HealthEquity account online to see required payment to the doctor. 3.Pay with your HSA funds through your HealthEquity online account. Give doctor’s office your Blue Shield card so BSC can…  process the claim and get you their special provider discounts and  send info about your amount of claim responsibility to Health Equity Using Your Health Savings Plan

17 1.Go to your pharmacy. 2a. Pay for your Rx immediately if you want to use your HSA Debit Card, OR 2b. Pay with personal funds (e.g., AMEX to get your points) and later go to your HealthEquity account online and reimburse yourself. Give Pharmacist your Blue Shield Card so they can apply the Blue Shield Rx discounts. Using Your Health Savings Plan

18 Transition of Care Policy – Overview All plans provide temporary transition of care services so members may complete a course of treatment and arrange for a safe transfer from a non-plan provider. Bridges gap between old and new plans. Important for those currently under care from providers who will no longer be in- network under member’s new plan. However, eligibility is limited; not every member will qualify Employees who change plans voluntarily do not qualify

19  Pay bands adjusted annually, based on change in California consumer price index from February of prior year to February of current year (determined by the California Department of Finance).  Use index for urban wage earners and clerical workers (CPI-U).  Change from Feb 2012 to Feb 2013 was 2.4%. Updated Pay Bands 2013 Pay Band Definition of Range Using Full-Time Salary As of Jan $50,000 & Under 2$50,001 to $98,000 3$98,001 to $147,000 4$147,001 & Over 2014 Pay Band Definition of Range Using Full-Time Salary As of Jan $51,000 & Under 2$51,001 to $101,000 3$101,001 to $151,000 4$151,001 & Over

20 California Plans Contributions Pay Band 1 ($50,000 and Under) Pay Band 2 ($50,001 to $98,000) Pay Band 3 ($98,001 to $147,000) Pay Band 4 ($147,001 and Over) UUCUAUACUUCUAUACUUCUAUACUUCUAUAC Health Net B&G HMO$25.26$45.47$101.25$121.45$61.31$110.36$183.55$232.59$98.31$176.96$257.31$335.95$136.62$245.92$333.73$ Health Net HMO$108.28$194.91$275.59$362.21$144.33$259.80$357.89$473.35$181.33$326.40$431.65$576.71$219.64$395.36$508.07$ Kaiser$9.67$17.41$20.31$28.04$45.72$82.30$102.61$139.18$82.72$148.90$176.37$242.54$121.03$217.86$252.79$ WHA$9.67$17.41$20.31$28.04$45.72$82.30$102.61$139.18$82.72$148.90$176.37$242.54$121.03$217.86$252.79$ Anthem PLUS$75.43$135.77$206.61$266.94$111.48$200.66$288.91$378.08$148.48$267.26$362.67$481.44$186.79$336.22$439.09$ Anthem PPO$106.76$192.17$272.40$357.80$142.81$257.06$354.70$468.94$179.81$323.66$428.46$572.30$218.12$392.62$504.88$ Anthem CDH$9.67$17.41$20.31$28.04$45.72$82.30$102.61$139.18$82.72$148.90$176.37$242.54$121.03$217.86$252.79$ Contributions Pay Band 1 ($51,000 and Under) Pay Band 2 ($51,001 to $101,000) Pay Band 3 ($101,001 to $151,000) Pay Band 4 ($151,001 and Over) UUCUAUACUUCUAUACUUCUAUACUUCUAUAC Health Net B&G HMO$29.49$51.17$109.50$131.18$65.54$116.06$191.80$242.32$102.54$182.66$265.56$345.68$140.85$251.62$341.98$ Kaiser$11.78$21.20$25.80$35.21$47.83$86.09$108.10$146.35$84.83$152.69$181.86$249.71$123.14$221.65$258.28$ WHA$11.78$21.20$25.80$35.21$47.83$86.09$108.10$146.35$84.83$152.69$181.86$249.71$123.14$221.65$258.28$ BSC–HSP$9.67$17.41$21.19$28.92$45.72$82.30$103.49$140.06$82.72$148.90$177.25$243.42$121.03$217.86$253.67$ UC Care$71.96$127.83$198.99$254.87$108.01$192.72$281.29$366.01$145.01$259.32$355.05$469.37$183.32$328.28$431.47$ $ DifferencePay Band 1Pay Band 2Pay Band 3Pay Band 4 UUCUAUACUUCUAUACUUCUAUACUUCUAUAC Health Net B&G HMO$4.23$5.70$8.25$9.73$4.23$5.70$8.25$9.73$4.23$5.70$8.25$9.73$4.23$5.70$8.25$9.73 Kaiser$2.11$3.79$5.49$7.17$2.11$3.79$5.49$7.17$2.11$3.79$5.49$7.17$2.11$3.79$5.49$7.17 WHA$2.11$3.79$5.49$7.17$2.11$3.79$5.49$7.17$2.11$3.79$5.49$7.17$2.11$3.79$5.49$7.17 BSC–HSP*$0.00 $0.88 $0.00 $0.88 $0.00 $0.88 $0.00 $0.88 UC Care vs. PPO($34.80)($64.34)($73.41)($102.93)($34.80)($64.34)($73.41)($102.93)($34.80)($64.34)($73.41)($102.93)($34.80)($64.34)($73.41)($102.93) UC Care vs. POS($3.47)($7.94)($7.62)($12.07) ($3.47)($7.94)($7.62)($12.07)($3.47)($7.94)($7.62)($12.07) ($3.47)($7.94)($7.62)($12.07) UC Care vs. HNHMO($36.32)($67.08)($76.60)($107.34) ($36.32)($67.08)($76.60)($107.34)($36.32)($67.08)($76.60)($107.34) ($36.32)($67.08)($76.60)($107.34) * BSC-HSP was compared to Anthem Lumenos 2013 & 2014 Contribution Rates

21 New plan provisions for medical plans 21

22 Smoking Cessation Programs Blue Shield: Quit For Life –1-866-QUIT-4-LIFE ( ) –www.quitnow.net/blueshieldca Health Net: Decision Power (for smoking cessation) –www.healthnet.com/uc Kaiser: Quitsmoking –www.kp.org/quitsmoking Optum (Wellness): Quit Power –coming in 2014

23 Rx – Mandatory Generic Generic will automatically be dispensed Brand-name drug when generic is available costs member: –$5 generic copay* + (brand price – generic price) Brand available if medically necessary (e.g., allergic to inactive ingredient) –Preauthorization required to determine if medically necessary –DAW, DNS or similar wording does NOT = medically necessary –Member pays brand copay* * For BSC Health Savings Plan & Core - When a generic drug is available and you choose the brand-name drug, you must pay coinsurance on the cost of the generic drug plus the difference between the cost of the brand- name drug and the generic equivalent. With prior authorization, exceptions for medical necessity can be made and you pay coinsurance on the cost of the brand-name drug.

24 Kaiser These additional preventive care benefits will be available at no charge: – Genetic testing for breast cancer susceptibility – Women’s contraceptive items that by law do not require a prescription – Aspirin to reduce heart attack risk – Folic acid supplements for pregnant women to reduce the risk of birth defects – Fluoride supplements for children to reduce the risk of tooth decay – Iron supplements for children

25 New plan provisions for non-medical plans 25

26 UC Living Well – Relaunch UC will relaunch UC Living Well wellness program in 2014 with Optum Continue to earn points toward an incentive award by participating in activities and wellness coaching – Available to all actives and retirees and their spouses / DP’s enrolled in UC medical plans – including Kaiser! – Focus on campus-based activities – Health Assessment – $75 gift cards incentive for actives and retirees only – Spouses and domestic partners no longer eligible for incentive award; they may use wellness website and online tools

27 Dental/Vision Plan Changes DeltaCare USA Added Benefits –Procedures to assess the level of risk associated with dental decay –Gingival irrigation, a procedure to treat gums with medical solutions for health purposes Vision Service Plan Diabetic Eye Care Plus Program –Now extended to cover both Type I & II Diabetic members. –Provides diabetic eye exam in addition to the routine vision examination ($20 copay) Retiree Vision open for Enrollment

28 Group Legal Plan – Benefit Enhancements 1.Real Estate Disputes Legal disputes about contracts or obligations for purchase, sale or financing of the named insured’s primary residence. Example: Member purchases primary residence and the seller is not making needed repairs per the sales agreement. 2. Personal Property Protection Legal disputes about contracts or obligations for the transfer of personal property or legal disputes about personal property rights. Example: Plan member sold their car and only received half of the purchase price. Beginning 1/1/2014: Covered in full if using ARAG Attorney – Limits apply otherwise 4. Estate Administration and Closing – up to 9 hours Legal services for an insured in administering an estate when named as the executor. 5. Small Claims Court Legal services for an insured to obtain advice and counseling to bring a claim or defend an action in Small Claims Court. 3. Minor Traffic Legal defense for an insured in the defense of a traffic offense, as long as conviction would not result in suspension or revocation of license.

29 Flexible Spending Accounts Health FSA Enroll or re-enroll $2,500 annual limit Blue Shield Health Savings Plan members not eligible to participate in UC’s Health FSA If employee enrolls in the Blue Shield Health Savings Plan during this Open Enrollment, Health FSA must have a $0 balance on Dec. 31, 2013 (complete any claims reimbursement by Dec. 31, 2013) DepCare FSA Enroll or re-enroll $5,000 ($2,500 if married and filing a separate tax return) annual limit

30 Important Dates Open Enrollment Period October 28 th at 8:00 am to November 26 th at 5:00 pm Benefits Fair -- October 29 Westwood – RRUCLA & RNPH B-Level Café 7:30 am – 1:00 pm Santa Monica Conference Center 2:30pm – 4pm Management Forum – October 22 Open Enrollment presentation

31 Open Enrollment Education Schedule Presentations with Q & A  Oct 15 & Oct 18: HR Department Contact Meeting  Oct 24: FPG presentation with Q & A 10:30am – 2pm  Nov 4: FPG presentation with Q & A 10:30am – 2pm  Nov 8: RRUCLA pm – 5pm  Nov 12: SMUCLA Room 1 G350 1:30pm – 2:30pm  Nov 14: 200 Med Plaza am – 2pm  Nov 18: SMUCLA Room G360 3pm – 4pm  Nov 20: RRUCLA B-Level Café 11:30a – 1:30p


Download ppt "2014 Open Enrollment Benefits. 2014 Medical Plans 2013 (7 plans)2014 (5 plans) Anthem PPO Anthem PLUS Anthem HRA-PPO UC Care Blue Shield Health Savings."

Similar presentations


Ads by Google