Presentation is loading. Please wait.

Presentation is loading. Please wait.

The Gateway® Cloning System Cloning multiple fragments into a single vector Contents How to clone up to 4 DNA fragments simultaneously into one destination.

Similar presentations


Presentation on theme: "The Gateway® Cloning System Cloning multiple fragments into a single vector Contents How to clone up to 4 DNA fragments simultaneously into one destination."— Presentation transcript:

1 The Gateway® Cloning System Cloning multiple fragments into a single vector Contents How to clone up to 4 DNA fragments simultaneously into one destination vector. Examples of expression of multiple genes in HeLa cells. Example of testing the effects of promoters and regulatory elements on protein expression.

2 Invitrogen Proprietary & Confidential 2 MultiSite Gateway® - Extending the applications Your Application Gene1Gene2Gene3Gene4 Your Application Gene Protein Localization Gene Protein Purification Gene RNAi Gene Cell-Free Gene Protein interaction Gene Entry Clone PCR Gene synthesis ORF collection Library Your Source

3 Invitrogen Proprietary & Confidential 3 Sample Applications Optimized multigene delivery without co-transfection Expression of enzymatic pathways Expression of multi-subunit protein complexes Gene knock-down and rescue (controllable RNAi and heterologous gene expression from the same construct) Variable gene expression levels using different expression elements Combinatorial tagging

4 Invitrogen Proprietary & Confidential 4 CTGCTTTTTTGTACAAACTTG attB1 CAGCTTTCTTGTACAAAGTTG attB2 CAACTTTATTATACAAAGTTG attB3 CAACTTTTCTATACAAAGTTG attB4 CAACTTTTGTATACAAAGTTG attB5 Standard Gateway® MultiSite Gateway® More att sequences needed

5 Invitrogen Proprietary & Confidential 5 XXXX X X attB2attB5 attP2attP5 attR2attR1 attB5rattB1 attP5rattP1 attL5 attL1 attB2attB5attB1 attL2 attR5 PCR Fragments pDONRs Entry Clones Destination Vectors Expression clones 2-fragment MultiSite Gateway® Pro BP reactions LR reaction

6 Invitrogen Proprietary & Confidential 6 3-fragment MultiSite Gateway® Pro XX attB2attB1attB3attB4 attL4attL1attL2attL3 attR2attR1 Entry clones Destination vector Expression clone attR3attR4 Cm R ccdB attB4attB1 attP4attP1 XX attB3rattB4r attP3rattP4r XX attB2attB3 attP2attP3 XX PCR Fragments pDONRs BP reactions LR reaction

7 Invitrogen Proprietary & Confidential 7 4-fragment MultiSite Gateway® Pro XXXXXXXX XX X attB4attB5 attP4attP5 attB3rattB4r attP3rattP4r attB2attB3 attP2attP3 attR2attR1 attB5rattB1 attP5rattP1 attL5 X attL2attL3 attL1 attB2attB4attB3attB5attB1 attL4 attR4attR3attR5 PCR Fragments pDONRs Entry Clones Destination Vectors Expression clones BP reactions LR reaction

8 Invitrogen Proprietary & Confidential 8 MultiSite Gateway® Three-Fragment Vector Construction Kit Cm R XX Entry clones Destination vector attB3attB4attB2attB1 Expression clone attR1attL4attL3attR2 attR3attR4 attL2attL1 ccdB XXXX attB1rattB4 attP1rattP4 attB2attB1 attP2attP1 attB3attB2r attP3attP2r XX PCR Fragments pDONRs BP reactions LR reaction

9 Invitrogen Proprietary & Confidential 9 Typical recombinationExpected # colonies per Typical Results Number of recombining fragments 10 L reaction efficiency (%)

10 Invitrogen Proprietary & Confidential 10 In silico cloning using Vector NTI Advance TM 10.3 Primers for PCR reaction Cloning Strategy DNA of interest

11 Invitrogen Proprietary & Confidential 11 Shortcomings when co-transfecting two plasmids Plasmid 2 Plasmid 1 EGFP P CAG mRFP EGFPmRFPEGFP mRFP Courtesy of Dr. Imamoto, Osaka University, Japan

12 Invitrogen Proprietary & Confidential 12 Example: Expression of Multiple Genes in Human Cells A B CFPYFP B1B4YFP B3B2CFPpEF1 pCMV B5 B4YFP B3B2CFPpEF1 B1 pCMV

13 Invitrogen Proprietary & Confidential 13 pA BGH EGFP IRES Promoter Kozak or HeLa Determination of expression level of EGFP IRES ( Internal Ribosome Entry Site ) Kozak or Gtx 2xGtx 5xGtx 12xGtx EMCV mHCV2a mHCV33 mHCV45 aurora A cdc 2 cyclin B1 cyclin E CMV EF1-a ( CAG ) ( SV40 ) HCV2a HCV33 HCV45 Courtesy of Dr. Imamoto, Osaka University, Japan Rapid Testing of Expression Elements using MultiSite Gateway®

14 Invitrogen Proprietary & Confidential 14 pA EGFP IRES Promoter Kozak or HeLa Relative activity aurora A cdc 2 cyclin B1 cyclin E EF1-a CMV Transcriptional signals with KozakTranslational signals with CMV promoter Courtesy of Dr. Imamoto, Osaka University, Japan Rapid Testing of Expression Elements using MultiSite Gateway®

15 Invitrogen Proprietary & Confidential 15 Summary for MultiSite Gateway® Technology MultiSite Gateway® Three- Fragment Vector Construction Kit MultiSite Gateway® Pro Compatible with… Ultimate ORF clones attL1-attL2 entry clones attR4-attR3 DEST vectors MultiSite Gateway® Pro entry clones attR1-attR2 DEST vectors Available for… Only 3-fragment cloning 2-, 3-, or 4-fragment cloning Applications Vector construction Promoter analysis Vector construction Promoter analysis Expression of multiple genes in one plasmid Reporter analysis …and more


Download ppt "The Gateway® Cloning System Cloning multiple fragments into a single vector Contents How to clone up to 4 DNA fragments simultaneously into one destination."

Similar presentations


Ads by Google