Presentation is loading. Please wait.

Presentation is loading. Please wait.

Recognizing and Intervening with Intimate Partner Violence Intimate Partner Violence Patricia Janssen, BSN, MPH, PhD, UBC Dept of Health Care and Epidemiology,

Similar presentations

Presentation on theme: "Recognizing and Intervening with Intimate Partner Violence Intimate Partner Violence Patricia Janssen, BSN, MPH, PhD, UBC Dept of Health Care and Epidemiology,"— Presentation transcript:

1 Recognizing and Intervening with Intimate Partner Violence Intimate Partner Violence Patricia Janssen, BSN, MPH, PhD, UBC Dept of Health Care and Epidemiology, Child and Family Research Institute.

2 Intimate Partner Violence Any act of violence that results in or is likely to result in physical, sexual or psychological harm or suffering, including threats of such acts, coercion or arbitrary deprivation of liberty, whether occurring in public or in private life. United Nations 1993 Declaration on the Elimination of Violence

3 Measuring Violence against Women Statistics Canada, 2006 Women are more likely than men to be the victims of the most severe forms of spousal assault, spousal homicide, sexual assault, and criminal harassment (stalking) Men are twice as likely to be charged with spousal homicide as women. Female victims of spousal violence are more likely than males to report being injured, experience multiple assaults, and fear for their lives. Among female victims of spousal assault, 40%, stated that their children witnessed the assault.

4 The Myth Idyllic, tranquil and non-violent lifestyles

5 The Reality: Challenges in Rural Communities Distant from traditional resources Fewer local resources (shelters, legal advocacy) Women require transportation to leave Alienation through membership in a minority group Lack of anonymity

6 Rural vs. Urban Provider Perceptions Eastman, J Interpersonal Violence 2007;22:465. Addressing multiple health and social issues Social and cultural barriers to accessing agency help Religious/cultural beliefs and family pressure promote staying in the relationship Access to employment, housing means leaving the area Lack of complimentary services Catchment area is too large

7 Providers also find that they are challenged to: Stay in touch with current literature on prevention and intervention Be aware of other innovative programs Stay safe

8 Prevalence, Impact, Etiology

9 Prevalence of Intimate Partner Abuse Setting (Author)SampleAcuteLifetime US, 1995 (Abbot) %54.2% US, 1998 (Dearwater) %36.9% UK, 2004 (Boyle)2561%22.4% UK, 2004 (Sethi)1981%34.8% Canada, 1996 (Hayden)2439%45% Canada, 2004 (Cox)9832%51% Australia, 1995, (Bates)4011.7%25% Australia, 1996 (Roberts)1.2232%15.5%


11 Children who Witness Prevalence estimates range from 16-25% 20% meet criteria for PTSD ( Mertin et al, 2002) 60-75% are physically abused (Osofsky, review) Clinical behavioral problems more common in % ( 8 studies)

12 Longitudinal Effect of Intimate Partner Abuse on High-Risk Behavior Among Adolescents (11-22 yrs) R oberts et al.Arch Pediatr Adolesc Med 2003 IPV – 273/2236 males (12.2%) - 302/2206 females (13.7%) Abuse by an intimate partner precedes involvement in: – illicit substance use – antisocial behavior – violent behavior – suicidal behavior –depression Controlled for SES, # partners, baseline risk behavior, prior abuse.

13 Physical Abuse and Adverse Fetal/Neonatal Outcomes

14 Why? Learned by witnessing violence Cultural belief in a status that is central and deserving. Without empathy Effective means of maintaining control Failure of the criminal justice system to make the perpetrator accountable by charging and prosecuting Genetics: Nr2e1, MaoA.

15 Genetics of Aggressive Behaviour: Monoamine System Analyses James L. Kennedy MD FRCPC Head, Neurogenetics Section, Centre for Addiction and Mental Health; IAnson Professor of Psychiatry and Medical Science, University of Toronto & J Beitchman, S Ehtesham, H Mik, D Bender, G Subramanian

16 Serotonin Transporter Gene Structure 5 VNTR 3 AP1 SP1AP1 SP1 AP2 TATA Exon IXIV 44 bp ins / del aaaaaaagaataaaacatgcagcccccccagcatataaatgca II 5HTTLPR NB 5HTTLPR is functional: l/l assoc. with 2x expression than l/s or s/s

17 Level of Callous-Unemotional Traits in aggressive children vs 5HTT VNTR genotype 12/1210/1210/10

18 Sheard M, et al Effect of Lithium on Aggression in Prison Inmates Drug Free Drug Free Medication Months Mean Infractions Per Month

19 Risk Factors Perpetrator Age (younger) Less than high school education Unemployed Use of alcohol Non visible minority Non immigrant Victim Age (younger) Non visible minority Non immigrant Aboriginal Use of alcohol, tobacco, llicit drugs (consequence)

20 Presentation in the Emergency Room Characteristics of Visits Delay between time of injury and time of seeking help Injuries are inconsistent with explanation Repeat visits – frequency and severity increases Over protective partner, family or friend Explanation is changing, vague or non-specific

21 Presentation in the Emergency Room Characteristics of Injuries Often bilateral Patterned Proximal (abdomen, face upper torso) Multiple – in various stages of healing Defensive – hands, forearms

22 Chronic Illness Frequent headaches, especially migraines Gastrointestinal symptoms Chest pain, heart palpitations Dizziness, numbness, tingling of extremities Gynecological disorders non-specific pain pelvic inflammatory disease sexually transmitted disease Pregnancy loss


24 Assessment And Documentation

25 Are people willing to be asked? Bacchus, BJOG 2002 Yes, if safe, confidential, health professional is trained, empathic, and non-judgmental. (Qualitative design) Rodriguez, J Fam Pract 2001 Yes, if direct (qualitative) Friedman, Arch Intern Med 1992 Routine inquiry favoured by 78% of primary care patients; 90% believed physician could help (Survey) McNutt, L. JAMWA, % of shelter residents advocated routine screening

26 Will they act on offers of help? Kresnoff, M. Injury Prevention, 2002 Among 528 women identified as intimate partner victims in emergency departments, 84% agreed to see an advocate and 54% of those accepted case management. Among these, 50% remained free after 6 weeks.


28 For patient's nurse to complete prior to discharge. Please ask to spend a few minutes alone with your patient. If you need a translator, please do not use a family member. Please see reverse for Chinese translation, Punjabi and Vietnamese versions are in the domestic violence binders in the modules. Introduction: As health care providers we know that family violence affects womens health. Because of the widespread problem of family violence, it is routine in this hospital to ask everyone these questions. Question: Since you've been pregnant, have you been hit, slapped, kicked or otherwise physically hurt by an intimate partner? Yes ____ No ____ Have you been afraid of a current or former intimate partner during your pregnancy? Yes ____ No ____ Prior to your pregnancy, was your partner hurting you ?Yes ____ No ____ making you afraid?Yes ____ No ____ ************************************************************* 1. Provide safety planning if any answer is "yes". 2. Refer to a social worker if women would like one. (Guidelines for referral to social workers are located in the Domestic Violence Binder in every module.) 3. Offer her a community resources card. (in patient bathrooms, Chinese cards in Domestic Violence Binders). 4. Document above interventions(1- 3) in progress notes.

29 Asking and Responding: Gentle, direct The injuries you have suggest to me that someone has hit you. Did someone hit you? Non-blaming, non-judgmental We know that violence is common in the home; we ask everyone who comes here about it Dont press for disclosure Express belief in what she is saying I am sorry that happened to you Support It is not your fault No one deserves abuse I know it takes a lot of courage to tell me this Empower Would you like help with this problem today

30 Documentation: Who was present during the interview or examination Presenting problem Details in patients words of how injuries occurred Injury – type, location, length width, shape, colour depth, degree of healing, swelling Psychological demeanor Body diagram

31 Documentation: Laboratory and diagnostic tests Clothing Medical treatment How physical evidence was collected and stored Photos – with permission (2 sets) Use scale or ruler Sign and date Name and hospital ID number on picture Referrals and follow-up plans

32 Knowledge – Session I Prevalence Cycle of abuse Myths and Facts Stages of Leaving Health Effects Didactic, lecture style

33 Persuasion – Session II How to ask the question How to respond Referrals and resources Small groups, video, storytelling, disclosure

34 Classroom Training: Improves knowledge Changes attitudes Does not increase likelihood of assessment Does not increase documentation (Harwell, Am J Prev Med, 1998, Fenslow, Aust NZ J Public Health, 1999, Thompson, Am J Prev Med, 2000, Campbell, Academic Emerg Med, 2001, McCauley, Academic Medicine, 2003, Gerber, BioMed Central, 2003)

35 Janssen P, Landolt M, Grunfeld A. Assessing for Domestic Violence Exposure in Primary Care Settings: The Transition from Classroom to Clinical Practice. Journal of Interpersonal Violence, 2003;18: Domestic violence was unrelated to the chief complaint Didnt feel it was my role to discuss this issue with the patient Did not have time to raise the issue Did not feel that sufficient rapport with the patient had been established Was unable to see the patient in privacy

36 Model the change Observing assessment Practicing with feedback Documentation of outcome Discussion with colleagues

37 Confirming Change: Orientation for new staff Competency assessment Performance appraisal Policy and Procedure Support Systems in place for staff

38 Janssen P, Basso M, Costanzo R. Exposure to Domestic Violence among Obstetrical Nurses, Womens Health Issues, 1998:8: Presently or in the past, with current or previous partners: 1. emotional abuse 2. physical force 3. afraid of partner 4. controlled by partner 5. sexual activities you were uncomfortable with 38.1%

39 Intervention Keeping Women Safe



42 A Little Contact Makes A Big Difference One night at a shelter significantly decreased abuse with or without 10-wk advocacy program. Sullivan et al, 1999

43 Safety Planning Help her make a plan for the next time: Who will she call? Where can she go? Emergency bag outside the house Cash, credit card, drivers license, passports, birth certificate, immigration papers, care card, phone numbers, care keys and gas Copy of protective orders, custody papers Take the children Stay between him and the door Hide weapons

44 McFarlane et al. An Intervention to Increase Safety Behaviors of Abused Women Nurs Res 2002;51: Design RCT Setting Texas, n = 150, women seeking protection orders Protocol Six 10 min phone sessions on safety planning vs. usual care. Menu of 15 safety behaviors discussed

45 Safety Behavior Adoption Over 8-wks


47 McFarlane et al. Nursing Research, 2006 Design RCT Setting Texas, N = 360, English and Spanish-speaking women attending primary care clinics Protocol Nurse case manager: 20 minute session on safety behaviors, support, and listening Resource card vs. Screening and resource card

48 Results at six months Safety behaviors Sig. more safety behaviors for case management group, p =.03 Threats and assault Lower for both groups, p<.001 (10 threats less, 12 assaults less) Danger for lethal assault Lower for both groups p<.001

49 Law Enforcement Restraining orders –Understudied –Gives responsibility to police –Women know how to reach police –Women can initiate but –Attracts attention in a small community –25-30% of victims report

50 Health Workers Role These are usually complex cases There are no easy answers Focus on safety Be willing to talk about the relationship Have low expectations for dramatic change Urge small steps towards a healthier, more balanced life

51 A successful intervention means you have Acknowledged the problem Validated the victims experience Stated that they are not to blame Assessed safety needs Asked about safety of children Offered help Documented

52 A small community: Can bring people together Make changes more quickly Measure the problem and evaluate change Address social norms Build cultural identity Target resources

53 Who can help with prevention ? The teacher The veterinarian The local newspaper The dentist The community centre The church The neighbour The taxi driver The bus driver The landlord The social assistance worker In addition to the nurse, doctor and police officer,,,,

54 Formal Measures 1.Public awareness and leadership 2.Education (especially youth): Conflict resolution Substance abuse Identity Skill training 3.Health care Assessment Safety Planning and Referral 4.Law enforcement Coordinate crisis intervention Remove perpetrator 5.Municipal Emergency/transition housing Emergency transportation Emergency funds

Download ppt "Recognizing and Intervening with Intimate Partner Violence Intimate Partner Violence Patricia Janssen, BSN, MPH, PhD, UBC Dept of Health Care and Epidemiology,"

Similar presentations

Ads by Google