Presentation is loading. Please wait.

Presentation is loading. Please wait.

TIANJIN MEDICAL UNIVERSITY Different Tumorigenesis Of The Orthotopic And Hypodermic Models Of Papillary Thyroid Carcinoma Cells In Nude Mice. Ye Yan Metabolic.

Similar presentations


Presentation on theme: "TIANJIN MEDICAL UNIVERSITY Different Tumorigenesis Of The Orthotopic And Hypodermic Models Of Papillary Thyroid Carcinoma Cells In Nude Mice. Ye Yan Metabolic."— Presentation transcript:

1 TIANJIN MEDICAL UNIVERSITY Different Tumorigenesis Of The Orthotopic And Hypodermic Models Of Papillary Thyroid Carcinoma Cells In Nude Mice. Ye Yan Metabolic Diseases Hospital & Tianjin Institute of Endocrinology, Tianjin Medical University, Tianjin, China

2 TIANJIN MEDICAL UNIVERSITY BACKGROUND  Papillary thyroid carcinoma (PTC) is the most prevalent form accounting for 80% of all thyroid carcinoma.  PTC is frequently associated with RET/PTC1 rearrangement and BRAF V600E (T1799A) mutation, especially in the sporadic patients.

3 TIANJIN MEDICAL UNIVERSITY OBJECTIVE To observe and compare the different tumorigenesis of the orthotopic and hypodermic models of PTC cell lines in nude mice.

4 TIANJIN MEDICAL UNIVERSITY METHODS The following human PTC cell lines were used: TPC-1, B5-16 and B2-7. TPC-1 and B RET/PTC1 rearrangement B BRAF V600E mutation

5 TIANJIN MEDICAL UNIVERSITY The Orthotopic and hypodermic nude mice models of thyroid cancer.  Experimental animal: 8-week-old female nude mice.  Anesthesia: intraperitoneal injection of chloralic hydras.  Surgery: A 1-cm-long midline incision was made, then the underlying submandibular glands and the strap muscles were bluntly dissected. The thyroid was clearly exposed.  Orthotopic and hypodermic injection: 2*10 5 cells in D-Hanks was injected into the left thyroid gland and under back skin of nude mice, respectively. ◆ Observation time: At 4 and 12 weeks. ◆ Observation data : The weight of orthotopic thyroid tumor and hypodermic tumor. Serum FT3,FT4 were detected using chemiluminescent immunoassay.

6 TIANJIN MEDICAL UNIVERSITY RESULTS Marker TPC-1 B2-7 B5-16  B5-16:BRAF V600E (T1799A mutation) GGTGATTTTGGTCTAGCTACAG A GAAATCTCGATGGAGTGGGT CCCATCAGTTTGAACAG  TPC-1: GGTGATTTTGGTCTAGCTACAG T GAAATCTCGATGGAGTGGGTC CCATCAGTTTGAACAG  B2-7: GGTGATTTTGGTCTAGCTACAG T GAAATCTCGATGGAGTGGGTC CCATCAGTTTGAACAG GAPDH RET/PTC1 Marker TPC-1 B2-7 B5-16

7 TIANJIN MEDICAL UNIVERSITY The tumorigenesis of the orthotopic and hypodermic models of PTC cell lines in nude mice was remarkable dissimilarity. ◆ TPC-1 and B5-16 were 100% tumorigenic in the orthotopic and hypodermic mice models (n=10). ◆ However, B2-7 was only 10% tumorigenic in the orthotopic model, and it was negative in the hypodermic model (n=10).

8 TIANJIN MEDICAL UNIVERSITY The development of the orthotopic and hypodermic tumor in TPC-1 and B5-16 models for 4 weeks. PTC cell line nWeight of hypodermic tumor (mg) Weight of orthotopic tumor (mg) TPC ± ±2.1 B ± ±19.7 TPC-1 B5-16 mg

9 TIANJIN MEDICAL UNIVERSITY TPC-1 B5-16 mg The development of the orthotopic and hypodermic tumor in TPC-1 and B5-16 models for 12 weeks. PTC cell line nWeight of hypodermic tumor (mg) Weight of orthotopic tumor (mg) TPC ± ±66.4 B ± ±136.9

10 TIANJIN MEDICAL UNIVERSITY The level of thyroid hormone reflects the destroy of thyroid function in the orthotopic models. 4 weeks 12 weeks * * ** * *

11 TIANJIN MEDICAL UNIVERSITY The morphological changes of the orthotopic thyroid tumor (HE staining) TPC-1B5-16 Control

12 TIANJIN MEDICAL UNIVERSITY CONCLUSION  The growth of PTC cell lines needs different internal environment. The tumorigenesis of the orthotopic and hypodermic models of three PTC cell lines in nude mice was different.  The hypodermic or orthotopic PTC models should be chosen according to the study objective. The hypodermic model---Its operation and observation is easy and convenient. The orthotopic model ---Its phenotype is close to the primary PTC.

13 TIANJIN MEDICAL UNIVERSITY ACKNOWLEDGE  Professor LS.Teng and Dr WB.Wang, The First Affiliated Hospital, College of Medicine, Zhejiang University.  My teacher professor ZP.Chen,YQ.Yan and my workmate. Metabolic Diseases Hospital & Tianjin Institute of Endocrinology, Tianjin Medical University, Tianjin, China

14 TIANJIN MEDICAL UNIVERSITY


Download ppt "TIANJIN MEDICAL UNIVERSITY Different Tumorigenesis Of The Orthotopic And Hypodermic Models Of Papillary Thyroid Carcinoma Cells In Nude Mice. Ye Yan Metabolic."

Similar presentations


Ads by Google