Presentation is loading. Please wait.

Presentation is loading. Please wait.

Rec DNA II.1 The Human Genome Project Rec DNA II.2 2003 Completion of the Human Genome Programe Start of the „post-genomic era” 2001 First draft of the.

Similar presentations


Presentation on theme: "Rec DNA II.1 The Human Genome Project Rec DNA II.2 2003 Completion of the Human Genome Programe Start of the „post-genomic era” 2001 First draft of the."— Presentation transcript:

1

2 Rec DNA II.1 The Human Genome Project

3 Rec DNA II Completion of the Human Genome Programe Start of the „post-genomic era” 2001 First draft of the Human Genome HGP (HumanGenomeProject) NCBI:NationalCenter ofBiotechnologyInformation CeleraGenomics (privát szektor) CraigVenter FrancisCollins HGP (HumanGenomeProject) NCBI:NationalCenter ofBiotechnologyInformation CeleraGenomics (private sector) CraigVenter FrancisCollins

4 Rec DNA II.3 GTCCGGTCCC GGGACCCCCT GCCCAGGGTC AGAGGGGCGC CTACCTAGCT CACGGTCTTG GGCCGGAGGG AATGGAGGAG GGAGCGGGGT CGACCGCTCA GCTGTCCGCC CAGTTTCGGA GGCGGCCACG CGAGGATCAA CTGTGCAACG GGTGGGGCCG CGGCTGACCG TGGTGGTCGC GGGGGCTGAG GGCCAGAGGC TGCGGGGGGG GGGCGGCGGG ATGAGCTAGG CGTCGGCGGT TGAGTCGGGC GCGGAGTCGG GGGCAGGGGG AGCGGGCGTG GAGGGCGCGC ACGAGGTCGA GGCGAGTCCG CGGGGGAGGC GGGCAGAGCC TGAGCTCAGG TCTTTCTGCG TCTGGCGGAA CGGGCCTGGG AGGGAGGTTT TGCCAGATAC CAGGTGGACT AGGGTGAGCG CCCGAGGGCC GGGACGCACG CACGGGCCGG GTAGGATGGC GCTGGCGTCG ATGCCCGCGC GCTTCAGGGC CTGGTCTGGC CGCCCCTCCA TCCTTGTCGG TTTCTCGGGT CGCGGACCCC GCGCGGCGCC GGGCGATGCT GGCCTGCCCG TGGCCACCAC CTCGCTTCAT TCCCGTCTCT TTGGGCCGCC GCATTCGTCC ACGTGCCCGT CTCTCCCTGC GCAAAATTCC AAGATGAGCA AATACTGGGC TCACGGTGGA GCGCCGCGGG GGCCCCCCTG AGCCGGGGCG GGTCGGGGGC GGGACCAGGG TCCGGCCGGG GCGTGCCCGA GGGGAGGGAC TCCCCGGCTT GCGACCCGGC GTTGTCCGCG J.Watson, 1 st director of HGP The Human Genome Project ‘clone by clone’ technique: - Parallel construction of genetic and physical maps - Representation of the genome in ordered libraries The Human Genome Project ‘clone by clone’ technique: - Parallel construction of genetic and physical maps - Representation of the genome in ordered libraries

5 Rec DNA II.4 Mapping strategies: Physical Maps Cytogenetic (chromosomal) maps - binding pattern Cosmid contig maps ordered clones of overlapping libraries Restriction maps sites of known restriction enzymes DNA sequences High Low resolution

6 Rec DNA II.5 1 st aim: Find 30,000 markers (in average distance of 150,000 bp) Marker: a unique sequence The ‘clone by clone’ technique The ‘clone by clone’ technique 2 nd aim: - Isolate chromosomes - Cleave them with endonuclease (150,000 bp fragments) -Clone them (Bacterial Arteficial Chromosome, BAC clones)

7 Rec DNA II.6 3rd aim: Map the BAC clones with restriction endonuclease Put them in order! Ordered BAC libraries The ‘clone by clone’ technique The ‘clone by clone’ technique

8 Rec DNA II.7 Sequence the ends: GCCGAATCCAATTAGAAAAT TAGAAAATCACATTTACCAGTCTGA CCAGTCTGACCCCGCAAACGGGTTT bp (BAC) 1500 bp fragments (overlapping) Align the sequences: GCCGAATCCAATTAGAAAAT TAGAAAATCACATTTACCAGTCTGA CCAGTCTGACCCCGCAAACGGGTTT Sequencing the BAC clones

9 Rec DNA II.8 Craig Venter Celera: The „shotgun” methods 2000 bp and bp fragments AAGGACTTATG____________________GGACACAGGTTATGG GACTTA_____CGTTGGA GAGAGGACACA________________CGTTATATTG Sequencing of the ends and aligning by computer: Only physical maps

10 Rec DNA II.9 Representation of the human genome 1. Databases (‘in silico’) HGP: Celera: 2. A series of bacterial colonies (BAC libraries)

11 Rec DNA II.10 The ENTREZ database National Center of Biotechnology Institute, USA Surfing on the Net

12 Rec DNA II.11 Search for Homo Sapiens, DRD4 (dopamine D4 receptor gene) Surfing on the Net

13 Rec DNA II.12 Internet séta Chromosomal localization of the DRD4 gene

14 Rec DNA II.13 Internet séta nagyítás Search gene sequence

15 Rec DNA II.14 NCBI Entrez Gene

16 Rec DNA II.15 Online Mendelian Inheritance in Man (OMIM) OMIM: Database of mutations, diseases Known function of genes OMIM: Database of mutations, diseases Known function of genes Internet séta Review of the literature, references

17 Rec DNA II.16 Internet séta Exon – intron structure Exon (red box) – intron (red line) structure of a gene Direction of transcription

18 Rec DNA II.17 About 20,000 genes The “useful information” of the genome Less than 5% of the genome ??? 45% of the human genomes are “jumping genes” (transposones) LINEs (long interspread elements): 6 kb, 8500 copies, 25% of our genome replicates with reverse transcription many truncated forms (inactive) SINEs (short interspred elements): bp, 1,5 million copies 13% of our genome, replicates by using the SHINE machinery Others Duplicated human genes (pseudogenes) Simple repeats (e.g.. AAAAAAAAAAAAAA….) The ‘extra’ (‘junk’) DNA - Repeat sequences

19 Rec DNA II.18 Universal Protein Resource (Swiss-Prot, TrEMBL, és PIR egyesítése) NCBI Entrez Protein database Internet séta Protein databases

20 Rec DNA II Databases of transcription factors 2 transzkripciós faktor együtt Internet séta

21 Rec DNA II.20 The polymorphic nature of the human genome The polymorphic nature of the human genome Approx. 0.5% variations (15 million base pairs)

22 Rec DNA II.21 Unrelated humans: share % (the difference is about 3 x 106 bp) Mutations & Polimorphisms GAGGG A GCGC GAGGG T GCGC Human & apes: share ~ 95% “Similarity” in terms of gene sequence

23 Rec DNA II.22 GTCCGGTCCC GGGACCCCCT GCCCAGGGTC AGAGGGGCGC CTACCTAGCT CACGGTCTTG GGCCGGAGGG AATGGAGGAG GGAGCGGGGT CGACCGCTCA GCTGTCCGCC CAGTTTCGGA GGCGGCCACG CGAGGATCAA CTGTGCAACG GGTGGGGCCG CGGCTGACCG TGGTGGTCGC GGGGGCTGAG GGCCAGAGGC TGCGGGGGGG GGGCGGCGGG ATGAGCTAGG CGTCGGCGGT TGAGTCGGGC GCGGAGTCGG GGGCAGGGGG AGCGGGCGTG GAGGGCGCGC ACGAGGTCGA GGCGAGTCCG CGGGGGAGGC GGGCAGAGCC TGAGCTCAGG TCTTTCTGCG TCTGGCGGAA CGGGCCTGGG AGGGAGGTTT TGCCAGATAC CAGGTGGACT AGGGTGAGCG CCCGAGGGCC GGGACGCACG CACGGGCCGG GTAGGATGGC GCTGGCGTCG ATGCCCGCGC GCTTCAGGGC CTGGTCTGGC CGCCCCTCCA TCCTTGTCGG TTTCTCGGGT CGCGGACCCC GCGCGGCGCC GGGCGATGCT GGCCTGCCCG TGGCCACCAC CTCGCTTCAT TCCCGTCTCT TTGGGCCGCC GCATTCGTCC ACGTGCCCGT CTCTCCCTGC GCAAAATTCC AAGATGAGCA AATACTGGGC TCACGGTGGA GCGCCGCGGG GGCCCCCCTG AGCCGGGGCG GGTCGGGGGC GGGACCAGGG TCCGGCCGGG GCGTGCCCGA GGGGAGGGAC TCCCCGGCTT GCGACCCGGC GTTGTCCGCG Mutations: rare allele variations - usually monogenic disorders (in less than 1% of the human population) when the “misprint” is fatal GAGGGCGCGC ACGAGGTCGA TCTTTCTGCG TCTGGCGGAA AGGGTGAGCG CCCGAGGGCC ATGCCCGCGC GCTTCAGGGC CGCGGACCCC GCGCGGCGCC TCCCGTCTCT TTGGGCCGCC AAGATGAGCA AATACTGGGC GGTCGGGGGC GGGACCAGGG CGACCCGGC GTTGTCCGCG Azonosított monogénes öröklődésű betegségek Sickle cell anemia

24 Rec DNA II.23 2 ismétlődés 3 ismétlődés 4 ismétlődés 5 ismétlődés VNTR G C A C T A C C C G T G A T G G G C A T T A C C C G T A A T G G SNP … harmless misprints” Genetic polimorphisms: variations over 1% frequency in humans Single Nucleotide Polymorphism Variable Number of Tandem Repeats

25 Rec DNA II.24 Single Nucleotide Polymorphisms/ SNPs (pronounced “snips”) 90% of the known variations most SNPs have only two alleles Polymorphism - Mutation Polymorphism Neutral??? Risk factors more than 1%Frequencyless than 1% Effectdisease Mutation Length Polymorphism: repeat sequences

26 Rec DNA II.25 What is next?

27 Rec DNA II.26 What is next?

28 Rec DNA II.27 “Human - ape genome: 95% similarity What is the difference?” “Human - ape genome: 95% similarity What is the difference?”

29 Rec DNA II.28 High throughput methods in genome analyzes:Automated DNA sequencing High throughput methods in genome analyzes:Automated DNA sequencing ‘Color sequencing’ Based on dideoxy-chain termination (see also: Lehninger)... 3’ CAAGTCACCTTG CAAG AddA Terminating positions Sequencing reaction mixture: All the four dNTP All the four ddNTP with different fluorescent dye DNA polymerase, primer

30 Rec DNA II.29 + index Sequencing results:

31 Rec DNA II.30 DNA chip (oligonucleotide array) 1. Mutation analysis DNA chip (oligonucleotide array) 1. Mutation analysis 50 µm 1.2 cm ~ position One position: molecules

32 Rec DNA II.31 The oligonucleotide array Example: mutation analysis of a bp gene (e.g. CFTR) 4000 bp length – 4000 oligo 4 variations in the middle base: oligo 1–20 2–21 3–22... Arrays of a 20 bp oligo

33 Rec DNA II.32 sample Control (no mutation) Comparison with computer The result

34 Rec DNA II.33 DNA-chip 2: Expression Analysis by Micro-arrays


Download ppt "Rec DNA II.1 The Human Genome Project Rec DNA II.2 2003 Completion of the Human Genome Programe Start of the „post-genomic era” 2001 First draft of the."

Similar presentations


Ads by Google