Presentation is loading. Please wait.

Presentation is loading. Please wait.

Community progress toward an integrated toolbox and consensus map for oat Nick Tinker, Eric Jackson, Eric Jellen, Howard Rines, et al.

Similar presentations


Presentation on theme: "Community progress toward an integrated toolbox and consensus map for oat Nick Tinker, Eric Jackson, Eric Jellen, Howard Rines, et al."— Presentation transcript:

1 Community progress toward an integrated toolbox and consensus map for oat Nick Tinker, Eric Jackson, Eric Jellen, Howard Rines, et al

2 Summary What do we need (covered in previous talks) What do we have (quick re-cap) DArT markers : what and why ? New applications Put in context of yesterday morning Next steps - and the future – (Jellen, Jackson, Rines et al)

3 Marker types – advantages & use in oats Restriction + Hybridization: RFLP Random amplification: RAPD Restriction + amplification: AFLP Amplification of repeats: SSR Repeat-based amplification: IRAP, ISSR, REMAP, IMP Amplification + hybridization: DArT Targeted amplification: SRAP, SCAR Targeted – many methods: SNP Other Protein, morphology MASDiscoveryOats

4 Inventory of oat maps (hexaploid) Kanota x Ogle (ODonoughue et al. 1995, Wight et al. 2003) Kanota x Marion (Kianian et al. 1999, Groh et al. 2000) Clintland64 x IL86-5698 (Jin et al. 2000) Ogle x TAM 0-301 (Portyanko et al. 2001) Ogle x MAM17-5 (Zhu and Kaeppler 2003) Terra x Marion (De Koeyer et al. 2004) MN841801 x Noble (Portyanko et al. 2005) + + + Many other special purpose partial maps + + + Additional new maps, in progress… –Potoroo x Mortlock (Williams et al.) –Aslak x Matilda (Schulman et al.) –Buffalo x Tardis (Howarth et al.) –SolFi x HiFi (Rossnagel et al.)

5 Inventory of oat QTLs Based on survey of literature (Wight): –710 reported QTL in oat –From 49 different oat populations –43 different traits – 81 trait methods http:// avena.agr.gc.ca/oatgenes

6 Too much of a good thing? Some assembly required! Many markers, many maps, many QTLs Wheres the problem?

7 Comparative mapping ko_5 [0] acor254a [8] umn5047 [12] umn97b [18] wg605 [35] cdo1396 [44] cdo1165a [59] cdo393b [67] cdo1173b [72] umn5904b [76] wg282 [84] umn28brv [91] cdo1433 ogle_tam_4 bcd1150b [0] cdo1165a [10] cdo202 [35] cisu36b [37] cdo393a [40] umn214c [41] cisu72b [44] bcd1495a [46] plrk10b [52] kv1.9b [63] cdo618 [66] cisu35a [68] cdo1387 [73] umn51b [81] bcd1230a [91] cdo20 [96] cdo1081b [102]

8 What is missing from the oat toolbox ? An economical, efficient, and accurate method to –merge information from different maps –generate a master consensus map Quickly address new information in new germplasm –new crosses, association mapping –breeding applications Universal anchor markers –that anyone can use – available as a service –Locus-specific, retain identity –Can be put on future sequence framework SSR? SNP? Yes! – but we couldnt wait Not a Band-Aid solution

9 InstitutionsContacts AAFC (Canada)Nick Tinker, Steve Molnar CDC, U of Sask.Brian Rossnagel, Graham Scoles USDA + Cornell UniversityMark Sorrells, Jean-Luc Jannink Göteborg University, SwedenOlof Olsson IGER, UKCatherine Howarth, Tim Langdon NULS, NorwayÅsmund Bjørnstad Svalöf WeibullStine Tuvesson UFRGS BrazilLuiz C. Federizzi University of IllinoisFred Kolb USDA Aberdeen, IdahoMike Bonman, Eric Jackson USDA + Univ. MinnesotaHoward Rines, Marty Carson, Deon Stuthman USDA + Purdue Univ.Joe Anderson, Herb Ohm Oat DArT consortium + Andrzej Killian, DArT P/L. Australia

10 DART – Marker Discovery Pooled Genomic DNA - From 100 global varieties - Reduced complexity - Random clones - 3 discovery arrays -6500 spots per array - (20K potential markers) Genomic Samples From 200 global varieties + 80 KxO mapping lines Label, hybridize, wash, and scan

11 Differential spot (usually from differential restriction or amplification in complexity reduction step) Score these on discovery panel + mapping lines Make second-generation typing array Optional: sequence clones Variety-1 Variety-2 ….. Variety-200 DART – Marker Discovery 010

12 Preliminary results (before sequencing)

13 200 varieties + 80 KxO lines 2000 polymorphic clones < 2000 unique (1400) > 2000 in next arrays (2700) = about 2000 markers 1000 mapped in KxO

14 Winter Spring Dendrogram based on DArT

15 Comparison to the old map: (example) Cluster of markers New DArT mapWight et al…. ko_DArT_G1 [0] 454714 [3] 454204 [5] 468309 [6] 455151 [7] 468816 [8] 466372 [10] estd [18] bglucanase [22] 465771 [23] 452799 [23] 453382 [24] 466075 [25] 463651 [33] 468706 [34] 453818 [34] 452401 [35] 466890 [37] 463786 [41] 466082 [42] 468762 [43] 397085 [45] 451275 [49] 388110 [52] 467722 [54] 463435 [54] bcd1968b [58] umn220 [62] 412525 [68] 450476 [72] bcd808b [76] umn624 [83] 415995 [85] 456275 [90] 463998 [92] cdo590a [96] cdo795a [99] 464463 [100] 468600 [105] 451513 [106] 456262 [107] 454921 [108] 454164 [112] 451699 [113] 451986 [113] 392483 [114] 454993 [116] 413966 [117] 464950 [119] 391188 [125] 451003 [131] 414509 [136] 397106 [136] 390797 [139] bcd961 ko_24_26_34 umn5245_3 [0] isu1874a [6] estd [13] bglucanase [24] bcd1968b [40] umn220 [43] bcd808b [53] umn624 [58] cdo590a [70] cdo795a [76] aco139rv [87] cdo353a [90] re2m2_12x [104] wacacaa378 [115] cdo373 [122] bcd961 [132] isu1651 [142]

16 Refining results (and adding value) 2700 DArT clones were sequenced (thanks: NAMA, Joe Anderson, Purdue)

17 Assembly of 2700 DArT clone sequences Singletons + consensus = 1800 unique sequences Number of sequences Singletons (1280) 2 x 290 = 580 318 192 Number of Contigs Singletons X 1280 290 106

18 Example of SSR and SNPs in DArT contig SNPs SSR

19 BLAST similarity of 1800 unique sequences of 1800 non redundant sequences 800 have a BLAST hit with E-value < 10E-5 < 10E-5

20 BLAST DArT against rice genome on NCBI: Clone#1 Clone#2

21 Oat vs Rice by DArT clone homology bcd269 [0] opt-16849 [3] opt-9873 [4] opt-2121 [5] opt-16786 [6] opt-11714 [9] opt-10919 [10] opt-14516 [12] opt-13366 [12] e8m3_13x [13] cdo772 [18] opt-6787 [18] opt-14599 [19] umn202 [23] opt-3486 [25] kod_33

22 Cost and availability of DArT Available to non-consortium as soon as paper is accepted (fall 2008 ?) Paper will contain detailed resources Add information to Graingenes All sequence will be submitted DiversityArrays.com Current cost of 2700-clone genotyping array: –$AUD 5500 (approx. 5K) –94 genotypes

23 The way forward Snapshots of new initiatives and opportunities –Not all DArTS Integrative mapping and chromosome assignment (Segue to Rick Jellen)

24 At AAFC DArTs will be cornerstone of AAFC team project on association mapping –Panel of 350 lines of global origin –Everyone look for your favourite trait –Overlaps (complements) other panels: Jean Luc ERA proposal DArTs will integrate targeted projects…….

25 Candidate genes: VRN1 – VRN3 Nava, Federizzi, Wight, Tinker 22 24 629b97b 201b 1 23 62b272b F R F R 23 F R exon intron Consensus sequence: ATGGCCGGKAGGGAYAGGGAYCCGCTGGTKGTYGGCAGGGTTGTGGGGGACGTGCTGGACCCCTTCGTCCGRACCACCAACCTCAGGGTGACCTTCG GGAACAGGRCCGTGTCCAACGGCTGCGAGCTCAAGCCGTCCATGGTCGCCCAGCAGCCSAGGGTKGAGGTGGGCGGCAATGAGATGAGGACCTTCTA CACRCTC……………………GTGATGGTAGACCCAGATGCTCCAAGTCCWAGCGAYCCCAACCTTAGRGAGTATCTCCACTG…………GCTTGGTGACAGATAT CCCSGGTACAACTGGKGCGTCGTTCGGGCAGGAGGTGATGTGCTACGAGAGCCCTCGTCCRACCATGGGGATCCACCGCTTCGTGCTCGTRCTCTTC CAGCAGCTSGGGCGGCAGACGGTGTACGCCCCCGGGTGGCGCCAGAACTTCAACACCAGGGACTTYGCCGAGCTCTACAACCTCGGCCMGCCYGTYG CCGCCGTCTACTTCAACTGCCAGCGYGAGGCCGGCTCCGGCGGCAGGAGGATGTACAATTGA 629b97b AACCTCAGGGTGACCTTCG TGATGGTAGACCCAGATGCTC GCAATGAGATGAGGACCTTCT CAGGAGGTGATGTGCTACGA GTCTACTTCAACTGCCAGCG

26 KO 24-26-34 UFRGS8 x 605 Group 6 468688a [0] 466075a [0] 454949b [2] 454898b [3] 465088a [4] 454292a [6] 463435a [15] 464848a [17] 450476a [19] 455563a [21] 464623b [34] 453284b [34] 454164b [34] 451986a [42] 464950b [44] 455189b [58] 452593b [58] 5 10 152025 QTL 0 0.10.2 0.3 0.40.5 0.6 Association Mapping R2 (unadjusted) Vernalization QTLs In wheat and barley ? QTL for un-vernalized days-to-flower

27 Other current initiatives (posters etc) New maps and new traits…. Various projects in evolution and diversity Rossnagel et al – DArT breeder friendly Olof Olsson – Tilling + ESTs *10K available now Jackson, Anderson et al : improve SSR toolbox –Then on to SNPs –Both SSRs and SNPs to incorporate DArTs

28 Two key puzzle pieces (segue to Rick… ) Ogle x TAM O-301 (136 RILs) – any day now –Expect 1000 mapped markers –700 common to KxO –Eric Jackson – expanding population by 200 RILs –Plus other maps –Consensus mapping will still be a challenge Physical chromosome assignment –Need to expand work by Fox et al. –New strategies ….

29 Oat Workshop at PAG Genome XVII Saturday - January 10, 2009 PAG - San Diego - www.intl-pag.orgwww.intl-pag.org 4:40 pm - 6:50 pm

30 Colleagues and staff at AAFC Charlene Wight Steve Molnar, Judith Fregeau-Reid Weikai Yan, Jennifer Mitchel-Fetch and many others…. Collaborators in the DArT consortium Itamar Nava and Luiz C. Federizzi The Quaker Oats Company, NAMA


Download ppt "Community progress toward an integrated toolbox and consensus map for oat Nick Tinker, Eric Jackson, Eric Jellen, Howard Rines, et al."

Similar presentations


Ads by Google