Presentation is loading. Please wait.

Presentation is loading. Please wait.

Genes, peoples, and languages across the Western Mediterranean David Comas Unitat de Biologia Evolutiva Universitat Pompeu Fabra Barcelona

Similar presentations


Presentation on theme: "Genes, peoples, and languages across the Western Mediterranean David Comas Unitat de Biologia Evolutiva Universitat Pompeu Fabra Barcelona"— Presentation transcript:

1 Genes, peoples, and languages across the Western Mediterranean David Comas Unitat de Biologia Evolutiva Universitat Pompeu Fabra Barcelona

2 Sahara Desert

3 Objectives Elucidate the genetic structure of NW African and SW European populations Compare the genetic composition of both Mediterranean shores Detect possible sub-Saharan Africa admixture in NW Africa Compare the genetic composition of Berber and Arab populations in NW Africa

4 Genetic markers Classical polymorphisms: proteins Autosomal markers: STRs, Alu insertions Uniparental markers: Y-chromosome and mtDNA DNA markers

5 Cavalli-Sforza LL, Menozzi P, Piazza A (1994). The history and geography of human genes Classical genetic markers in Europe First Principal Component (28.1%)

6 Classical genetic markers in North Africa First Principal Component (36.5%) Bosch E, Calafell F, Pérez-Lezaun A, Comas D, Mateu E, Bertranpetit J (1997) Population history of North Africa: evidence from classical genetic markers Hum Biol 69:

7 Simoni L, Gueresi P, Pettener D, Barbujani G (1999) Patterns of gene flow inferred from genetic distances in the Mediterranean region Hum Biol 71: Classical genetic markers in the Mediterranean Sharpest genetic boundaries

8 From Arnaiz-Villena and Martínez-Laso (1997) Origen de ibéricos, vascos y argelinos Investigación y Ciencia A30-B18-DR3 A1-B8-DR3 A29-B44-DR7 A1-B57-DQ2 A11-B27-DR1 A30-B18-DR3 A1-B8-DR3 A29-B44-DR7 A33-B14-DR1 A30-B18-DR3 A33-B14-DR1 A1-B57-DQ2 A2-B35-DR11 Classical genetic markers: HLA evidence

9 Neighbor-joining tree based on 7 HLA loci Comas D, Mateu E, Calafell F, Pérez-Lezaun A, Bosch E, Martínez-Arias R, Bertranpetit J (1998) HLA class I and class II DNA typing and the origin of Basques. Tissue Antigens 51: Classical genetic markers: HLA evidence

10 PORTUGUESE BASQUES CATALANS ANDALUSIANS MOZABITES NC BERBERS ARABS SO BERBERS SAHARAWI Autosomal STRs (Short Tandem Repeats) D3S1358(TCTA) n vWA*(TCTA) n FGA(CTTT) n D8S1179(TCTA/G) n D21S11(TCTG/TA) n D18S51(AGAA) n D5S818*(AGAT) n D13S317(GATA) n D7S820*(GATA) n TH01 (CATT) n TPOX (AATG) n CSF1PO (AGAT) n (GATA) n (AGAT) n (AAAG) n (ATTT) n (GATA) n D11S2010 D13S767 D14S306 D18S848 D2S1328 D4S243 F13A1 FES / FPS D9S926 21STRs AACTTGCTAAGATAGATAGATAGATAGATAGCGCGCC AACTTGCTAAGATAGATAGATAGATAGCGCGCC

11 % AFRICAN AMERICANS MOZABITES SAHARAWI ARABS NC BERBERS SO BERBERS ANDALUSIANS PORTUGUESE ITALIANS EUROPEAN AMERICANS CATALANS BASQUES Bosch E, Calafell F, Pérez-Lezaun A, Clarimón J, Comas D, Mateu E, Martínez-Arias R, Morera B, Brakez Z, Akhayat O, Sefiani A, Hariti G, Cambon-Thomsen A, Bertranpetit J (2000) Genetic structure of north-west Africa revealed by STR analysis. Eur J Hum Genet 8: Autosomal STRs (Short Tandem Repeats)

12 Alu insertion polymorphisms BASQUES CATALANS ANDALUSIANS ALGERIANS N. MOROCCANSW. MOROCCANS SE. MOROCCANS SAHARAWI TUNISIANS Alu element A25ACEAPOB65D1FXIIIBPV92TPA25HS243HS323HS Alu insertion polymorphisms -/- +/-+/+

13 Comas D, Calafell F, Benchemsi N, Helal A, Lefranc G, Stoneking M, Batzer MA, Bertranpetit J, Sajantila A (2000). Alu insertion polymorphisms in NW Africa and the Iberian Peninsula: evidence for a strong genetic boundary through the Gibraltar Straits. Hum Genet 107: Alu insertion polymorphisms

14 Basque Andalusian Catalan Northern Moroccan Western Moroccan S. Eastern Moroccan Saharawi Tunisian Algerian Neighbor-joining tree of populations 11 Alu insertion loci 1,000 bootstrap iterations NW Africans Iberians Alu insertion polymorphisms

15 S.Eastern Moroccan Saharawi Western Moroccan Catalan Andalusian Basque Northern Moroccan Tunisian Algerian First PC (48.0%) Second PC (20.8%) Principal component analysis of the Alu insertion frequencies Alu insertion polymorphisms

16 !Kung Nguni Bantu SEMoroccans Saharawi Algerians Tunisians WMoroccans NMoroccans Catalans Swiss Bretons French Basques Andalusians ,000 bootstrap iterations Sub-Saharans NW Africans Europeans Alu insertion polymorphisms Neighbor-joining tree of populations 11 Alu insertion loci

17 First PC (44.9%) Second PC (24.2%) Principal component analysis of the Alu insertion frequencies Alu insertion polymorphisms Sub-Saharans NW Africans Europeans

18 ? ? 3 individuals: 2 Basques and 1 Northern Moroccan Alu insertion polymorphisms Larger Alu insertion in PV92 locus

19 Alu element Alu insertion polymorphisms Larger Alu insertion in PV92 locus Comas D, Plaza S, Calafell F, Sajantila A, Bertranpetit J. (2001) Recent insertion of an Alu element within a polymorphic human-specific Alu insertion. Mol Biol Evol 18:85-88

20 Alu insertion polymorphisms Larger Alu insertion in PV92 locus 3 individuals: 2 Basques and 1 Northern Moroccan

21 Uniparental markers: Y-chromosome and mtDNA mtDNA autosomes Y chromosome

22 Uniparental markers: Y-chromosome and mtDNA Five generations MALE FEMALE 16 Great-great grandparents Son Father Mother 4 Grand- parents 8 Great- grand- Parents 32 Great great-great grandparents

23 Uniparental markers: Y-chromosome and mtDNA Y Adam and mtDNA Eve generations MRCA

24 Uniparental markers: Y-chromosome and mtDNA mtDNA phylogenyY-chromosome phylogeny

25 Uniparental markers: Y-chromosome and mtDNA Phylogeography: ex. Y-chromosome

26 Uniparental markers: Y-chromosome and mtDNA Gender specific behaviours Patrilocality: females are more likely to move from their birthplace upon marriage than males Polygyny: certain men father a disproportionately large number of children compared to other men

27 Y-chromosome lineages BASQUES CATALANS ANDALUSIANS NC BERBERS ARABS SO BERBERS SAHARAWI DYS388 DYS19 DYS390 DYS391 DYS392 DYS393 DYS389I DYS389II + 8 STRs 44 binary Bosch E, Calafell F, Comas D,Oefner PJ, Underhill P, Bertranpetit J (2001) High-resolution analysis of human Y-chromosome variation shows a sharp discontinuity and limited gene flow between Northwestern Africa and the Iberian Peninsula Am J Hum Genet 68:

28 E3a* Y-chromosome lineages

29 E3b2 Y-chromosome lineages

30 F* Y-chromosome lineages

31 R1* Y-chromosome lineages

32

33 Iberian Peninsula NW Africa North African Paleolithic substrate 75% Sub-Saharan genetic flow 8% North African genetic flow 5.2% Neolithic contribution 16.4% Neolithic contribution 13.6% European Paleolithic substrate 78.4% Iberian genetic flow 2.8% Y-chromosome lineages

34 Mauritanians Saharawis SBerbers MArabs NBerbers Mozabites Algerians Tunisians SItalians CItalians Tuscans Sardinians Catalans Basques Galicians Valencians Andalusians Central Spain NPortuguese CPortuguese SPortuguese Portuguese Sicilians Mitochondrial lineages Plaza S, Calafell F, Helal A, Bouzerna, Lefranc G, Bertranpetit J, Comas D (2003) Joining the Pillars of Hercules: mtDNA sequences show multidirectional gene flow in the Western Mediterranean Ann Hum Genet 67: HVS I Control Region + 4 SNPs Coding Region

35 mtDNA haplogroups defined by control region sequences and coding polymorphisms Mitochondrial lineages

36 First principal co-ordinate (55.4%) Second principal co-ordinate (12.7%) Valencians CS CI SPort Central Portuguese NorthPortuguese Portuguese Galicians Basques Catalans And Tus SouthItalians Sic Sard Mauritanians Saharawi SBerbers M Arabs M Berbers Mozabites Algerians Tunisians Plot of the two principal co-ordinate scores based on genetic distances

37 L1 L2 L3 Haplogroup L Mitochondrial lineages

38 U/K U6 Haplogroup U/K Italians Iberians North Africans U6b

39 H V HV Mitochondrial lineages Haplogroup H and V Italians Iberians North Africans

40 M1 Mitochondrial lineages Haplogroup M M5

41 Mitochondrial lineages Sened Matmata Chenini-Douiret

42 Mitochondrial lineages -3,0 -2,0 -1,0 0,0 1,0 2,0 3,0 -2,0 -1,0 0,0 1,02,0 W U6 V L2 L1 L3 U H M1 X J Other N K I T HV J/T Mozabites C.Moroccan2 Mauritanians Tuareg Saharawi Moroccan S.Moroccan Matmata Algerian Sened Tunisian C.Moroccan1 Egyptians Chenini-Douiret mtDNA haplogroup Arab Berber Fadhlaoui-Zid K, Plaza S, Calafell F, Ben Amor M, Comas D, Bennamar El Gaaied A (2004) Mitochondrial heterogeneity in Tunisian Berbers. Ann Hum Genet 68: Correspondence analysis based on haplogroup frequencies

43 Mitochondrial lineages Arabs1.54**98.46 Berbers6.24**93.76 Analysis of the molecular variance (AMOVA) ns not significat ** p < 0.01 Fadhlaoui-Zid K, Plaza S, Calafell F, Ben Amor M, Comas D, Bennamar El Gaaied A (2004) Mitochondrial heterogeneity in Tunisian Berbers. Ann Hum Genet 68: All populations4.14**95.86 Arabs-Berbers ns4.25**95.95 GroupsAmong groupsAmong populationsWithin populations

44 1) Clear genetic difference between NW Africa and SW Europe The Palaeolithic and Neolithic may have run in parallel along the two shores Gibraltar Straits may have acted as a geographical barrier Little genetic impact in Iberia of Arab occupation Western Mediterranean populations: Conclusions

45 2) Sub-Saharan flow detected in some NW African samples Continuous gene flow through the Sahara desert South-north gradient of sub-Saharan admixture Western Mediterranean populations: Conclusions

46 3) No differences between Berber and Arab samples Arabisation in the Maghreb (7th and 11th C A.D.): Cultural replacement with little demographic impact Western Mediterranean populations: Conclusions

47 4) Greater heterogeneity in NW Africa Genetic drift in isolated populations Differential genetic admixture Population sampling bias ?

48 Genes, peoples, and languages across the Western Mediterranean David Comas Unitat de Biologia Evolutiva Universitat Pompeu Fabra Barcelona


Download ppt "Genes, peoples, and languages across the Western Mediterranean David Comas Unitat de Biologia Evolutiva Universitat Pompeu Fabra Barcelona"

Similar presentations


Ads by Google