Presentation is loading. Please wait.

Presentation is loading. Please wait.

DNA: Structure, Dynamics and Recognition Les Houches 2004 L3: DNA dynamics.

Similar presentations


Presentation on theme: "DNA: Structure, Dynamics and Recognition Les Houches 2004 L3: DNA dynamics."— Presentation transcript:

1 DNA: Structure, Dynamics and Recognition Les Houches 2004 L3: DNA dynamics

2 STRUCTURAL DATABASES

3 RSCB-PDB H.M. Berman, J. Westbrook, Z. Feng, G. Gilliland, T.N. Bhat, H. Weissig, I.N. Shindyalov, P.E. Bourne Nucleic Acids Research, 28 pp (2000)

4 RSCB

5 Full search

6 Custom forms

7 An example - chymotrypsin

8 Display

9 PDB file header

10 NDB -http://ndbserver.rutgers.edu/

11 NDB - atlas

12

13 CCDC

14 CSD – small molecules

15 CCDC products

16 TRANSFAC -

17 HELICAL PARAMETERS

18 Helical symmetry - move between residues by translation along and rotation around the helical axis

19 Finding a helical axis (1) Build vectors between helically equivalent atoms (2) Find plane defined by vectors placed at origin (3) Draw perpendiculars to chords between heads of vectors

20 Curved helical axis ?

21 Cambridge convention Dickerson et al. J. Mol. Biol. 205, 1989, 787

22 Helical parameters TranslationRotation

23 Helicoidal parameters Local Global

24 Extreme global solutions Keep linear helical axis Keep monomer orientations

25 CURVES R. Lavery and H. Sklenar J. Biomol. Struct. Dyn. 6, 1989, 655

26 Base reference system

27 Axis reference system

28 Curves function A) Bases (X, E) in the same place with respect to the local axis (U, P) ? A1) Rotation (U i.X i - U i-1.X i-1 ) 2 - where X = J, K, L A2) Translation [(P i - E i ).X i - (P i-1 - E i-1 ).X i-1 ) 2 B) Axis straight and continuous ? B1) Rotation (U i - U i-1 ) 2 B2) Translation (Q i - Q i-1 ) 2 - where Q i = (P i - P i-1 ) -.[.(P i - P i-1 )] Final formula: F (X,Y,I,T) = 10 (A1 + B1) + (A2 + B2)

29 Curves helical axis

30 Parameter B-DNA A-DNA Xdisp Ydisp Inclination Propeller G-Slide G-Rise G-Roll G-Twist L-Slide L-Rise L-Roll L-Twist Phase15518 Amplitude4042 Helical parameters for B- and A-DNA

31 B-DNA structural variation ValueMin.Max.MeanValueMin.Max.Mean Xdisp Shift Inc11 Slide Tip-11110Rise Buck-11161Tilt-880 Prop Roll Open-881Twist Pha Amp Hartmann and Lavery Q. Rev. Biophys. 29, 1996, 309

32 B-DNA - 2ns dynamic trajectory

33 "LONG" MD SIMULATIONS

34 Time integration of Newton's equation of motion: F = ma -dE/dr = m dr 2 /dt 2 Taylor expansion: r(t + t) = r(t) + t dr(t)/dt + t2/2 d 2 r(t)/dt 2 + … Fastest movements: O( s) Molecular dynamics r t

35 Periodic boundary conditions

36 Equilibration Temp (K) Time (ns) 123 Heat EquilibrateProduction NPT ensemble Reassign or rescale velocities Initially constrain solute Minimize

37 MD snapshots

38 MD time series - sugar phase - groove width

39 MD time series - base pair Hbonds

40 Ascona B-DNA Consortium USAEUROPE D. Beveridge, Wesleyan U. D. Case, Scripps Institute T. Cheatham, U. Utah R. Osman, Mount Sinai, NY M. Young, Berkeley F. Lankas, Herovsky Inst. Czech Republic EPFL R. Lavery, IBPC France J. Maddocks, EPFL Switzerland H. Sklenar, MDC Germany

41 136 unique tetramers AAAAAAACAAAGAAATAAGAAAGCAAGGAAGT AATAAATCAATGAATTACGAACGCACGGACGT AGAAAGACAGAGAGATAGCAAGCCAGCGAGCT AGGAAGGCAGGGAGGTAGTAAGTCAGTGAGTT ATAAATACATAGATATATGAATGCATGGATGT CAAACAACCAAGCAATCAGACAGCCAGGCAGT CATACATGCCGACCGGCGAACGACCGAGCGAT CGCACGCGCGGACGGCCGGGCGGTCGTACGTC CGTGCGTTCTAACTAGCTGACTGCCTGGCTGT GAAAGAACGAAGGAATGAGAGAGCGAGGGAGT GATAGATCGATGGCGAGCGCGCGGGGAAGGAC GGAGGGATGGCAGGCCGGCCGGGAGGGCGGGG GGGTGGTAGGTCGGTGGGTTGTAAGTACGTAG GTGAGTGCGTGGGTGTTAAATAACTAAGTAAT TAGATAGCTAGGTAGTTATATCGATGAATGAC TGAGTGATTGCATGGATGGCTGGGTGGTTGTA TGTCTGTGTGTTTTAATTGATTGCTTGGTTGT

42 ABC oligomers - construction G-D-ABCD-ABCD-ABCD-G 15 base pairs Central tetranucleotide repeats GC terminal base pairs for stability No sampling for i 13 Two copies of each tetranucleotide

43 39 oligomer database GGGGGGGGGGGGGAAAAAAAAAAAAACGCGCGCGCGCGC TATATATATATATAGAGAGAGAGAGATGTGTGTGTGTGT AGGGAGGGAGGGACGGGCGGGCGGGCTGGGTGGGTGGGT GAAAGAAAGAAAGCAAACAAACAAACTAAATAAATAAAT CGGCCGGCCGGCCAGGAAGGAAGGAATGGTTGGTTGGTT TAATTAATTAATTCGGACGGACGGACAGGCAGGCAGGCA AGGTAGGTAGGTATGGATGGATGGATCGGTCGGTCGGTC TGGCTGGCTGGCTCAAGCAAGCAAGCGAACGAACGAACG TAACTAACTAACTCAATCAATCAATCTAAGTAAGTAAGT GAATGAATGAATGTGAGTGAGTGAGTCGAGCGAGCGAGC TGCGTGCGTGCGTTAGATAGATAGATGACAGACAGACAG TACATACATACATAGCTAGCTAGCTATGCATGCATGCAT CGATCGATCGATCTGACTGACTGACTCGTACGTACGTAC

44 Simulation protocol AMBER program PARM94 parameters Truncated octahedral box (~7600 waters) Neutralising K + counterions Particle Mesh Ewald electrostatics 2 fs timestep (SHAKE on X-H) Careful equilibration, NVT NPT Save configuration every 1ps 15 ns trajectories (for Phase I)

45 ABC dataset – Phase I Finished 5/ months of CPU time 0.6 s of simulation ( 2.2x Vilin folding simulation ) 600,000 coordinate sets 272 tetranucleotide steps 400 Gb of data

46 ACGT trajectory B-DNA A-DNA Last ns

47 Helical parameters TranslationRotation

48 ACGT helical parameters - instantaneous

49 SYMMETRY?

50 Each oligomer contains 2 "identical" tetramers G-D-ABCD-ABCD-ABCD-G

51 ACGT helical parameters - histograms C 6 pG 7 C 10 pG 11

52 GCGC helical parameters - histograms C 4 pG 5 C 6 pG 7 C 8 pG 9 C 10 pG 11

53 GCGC helical parameters

54 Backbone torsion angles :C5 – C4 – C3 – O3 :O5 – C5 – C4 – C3 :P – O5 – C5 – C4 :O3 – P – O5 – C5 :C3 – O3 – P – O5 :C4 – C3 – O3 – P

55 CGCG backbone parameters G 7 pC 8 G 11 pC 12 C 6 pG 7 C 10 pG 11 g - /g + g + /t

56 transition - G 11 pC 12 g-g- g+g+ g+g+ t

57 impact on twist - G 11 pC 12 g-g- g+g+ g+g+ t

58 SEQUENCE DEPENDENT STRUCTURE?

59 CpG translational parameters

60 CpG rotational parameters

61 IONS AROUND DNA

62 Diffusion coefficients (10 -9 m 2 sec -1 ) = 6D dt K + D= 2.85 Exp=1.96 Na + D= 1.72 Exp=1.33

63 Volume sampled by ions during 50ns simulation time Na + K+K+

64 Most frequently visited zones Na+ K+

65 Tight binding phosphate strand 1C1C2A3T4G5C6G7C8T9G10A11C12 groove groove ,163 strand 2G24G23T22A21C20G19C18G17A16C15T14G13 phosphate phosphate strand 1 C1C2A3T4G5C6G7C8T9G10A11C12 groove127413,321 groove2221,113,83111,61,112 strand 2G24G23T22A21C20G19C18G17A16C15T14G13 phosphate Na + K+K+

66 Minor groove width at C8 level Na + K+K+

67 / transitions in Na + dynamics red green

68 / transitions in K + dynamics red green


Download ppt "DNA: Structure, Dynamics and Recognition Les Houches 2004 L3: DNA dynamics."

Similar presentations


Ads by Google