Presentation is loading. Please wait.

Presentation is loading. Please wait.

Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal.

Similar presentations


Presentation on theme: "Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal."— Presentation transcript:

1 procaryotes : a single circular chromosome typically base pairs eucaryotes : several linear chromosomes typically base pairs 22 autosomal chromosome pairs 2 sexual chromosomes Example : human genome + about hundred circular mitochondrial DNA molecules telomere centromere DNA is organized in chromosomes 1 5 µm

2 Structure and localization of chromosomes Chromosomes are made of DNA and proteins (chromatin). Histones make DNA more compact and regulate its accessibility (nucleosomes). Transcription factors control gene expression. Replication factors catalyze DNA replication during the S phase of the cell cycle. Individual chromosomes can be observed during mitosis, one step of cell division (chromatin condensation). Centromeres are contact points between pairs of chromosomes. Telomeres are chromosome ends. A diploid (haploid) cell possesses 2 (1) set(s) of chromosomes 2

3 Regulation of DNA accessibility play a crucial role during transcription and replication From ENCODE, an encyclopedy of DNA elements : 3

4 DNA replication DNA replication is semi-conservative DNA polymerases Replication origins Assembly of the replication fork Further readings : 1 ADN 2 ADN 4

5 DNA replication is semi-conservative M. Meselson & P Stahl Proc. Nat. Ac. Sci

6 6 The cell cycle Gap 1 DNA Synthesis Mitosis Gap 2 In the resting state (G 0 ), cells do not divide G0G0 6

7 Flow cytometry Up to 8 fluorophores can be simultaneously analyzed Fluorescence level Forward and side scattering is used to analyze cell size and granularity Analysis rate cells/sec Several analysis in parallel 7

8 The Fluorescence Activated Cell Sorter (FACS) 8

9 9 DNA synthesis is catalyzed by DNA-dependent DNA polymerases dNTP template strand strand to be synthesized DNA polymerization takes place in the 5 to 3 direction DNA polymerase requires a template and a primer dATP dTTP dCTP dGTP GGATCCTTAGAACCTTGGCCCGGG CCTAGGAATCTTGGAACCGGGCCC DNA polymerase nucleotides GGATC CCTAGGAATCTTGGAACCGGGCCC template primer 5 5 PP i Stryer et al. Biochemistry, Freeman Edt 9

10 DNA replication is catalyzed by a DNA-dependant DNA polymerase in the 5 to 3 direction starting at double strand DNA or at a DNA-RNA hybrid A primase synthesize a RNA primer to initiate replication DNA polymerases are processive : processivity is the number of phosphodiester bonds that a single enzyme is able to catalyze before dissocation DNA replication requires a primase to start dNTP template strand strand to be synthesized 10

11 11 Okazaki fragments RNA primase Leading and lagging strands Size of Okasaki fragments : eukaryotes 200 bp Alberts et al. MBOC, Garland Edt 11

12 dNTP RNA primer 5 3 NTP primase Replication fork DNAPol DNA helicase On the « leading strand », DNA is continuously synthesized 12

13 RNA primer dNTP RNA primer 5 3 NTP DNAPol primase 5 3 dNTP RNA primer ligase 5 3 RNA primer RNAse and DNAPol Replication fork DNAPol DNA helicase On the « lagging strand », DNA is synthesized discontinuously 13

14 14 The core of the eukaryote replication complex Movies 5.1 (Molecules and Complexes) and 5.4 (Cell functions) Mol. Biol. Cell Linda B. Bloom, University of Florida Eukaryote cells possesses several DNA polymerases (> 15) nucleus250 kDa DNA primase, lagging strand nucleus170 kDa leading strand nucleus260 kDa lagging strand, DNA repair DNAPol DNAPol primase 14

15 15 Main components of the DNA replication complex DNA polymerase – primaseprimer RNA synthesis DNA polymerase DNA synthesis, leading+lagging strands Replication protein C*load PCNA on DNA Proliferating cell nuclear antigen (PCNA)sliding clamp ensuring processivity TopoisomeraseAdjusts DNA supercoiling Helicase*Unwinds DNA into strands Replication protein Asingle strand DNA binding protein Flap endonuclease 1removes RNA 5-flap Dna2 RNase H1removes RNA DNA ligase 1joins Okasaki fragments * uses ATP The replisome The catalytic core Maga and Hübscher 1996 Biochemistry 35: Waga and Stillman 1994 Nature 269: Frouin et al EMBO reports 4: Hübscher and Yeon-Soo Seo 2001 Mol. Cells 12: Cyclin A, cyclin B1 Cyclin dependent kinase 1, 2 (CDK1, CDK2) + 11 other proteins… Temporal regulation 15

16 16 The central role of PCNA PCNA (proliferating cell nuclear antigen) is a homotrimeric protein that helps DNA polymerase processivity in eukaryotic cells. During the S-phase, it assembles around DNA and form a DNA clamp. PCNA associates with RFC, DNA polymerases and, Fen1/Dna2, Lig1 (+ 15 other proteins !) PCNA is also involved in DNA repair mechanisms At 3 OH end : RFC displaces Pol- and loads PCNA + Pol / At the flap structure : RFA dissociates Pol from PCNA PCNA recruits Fen1/Dna2 which cleaves the flap structure PCNA recruits Lig1 that joins the DNA fragments PDB 1AXC Maga and Hübscher 2003 Journal of Cell Science 116:

17 17 Replication is coordinated at replication factories Visualization of DNA replication in living cells using GFP-PCNA FRAP experiments shows that PCNA is stably associated to replication factories Essert et al Mol. Cell Biol. 25 : PCNA GFP 17

18 18 Replication is coordinated at replication factories Visualization of DNA replication in living cells using GFP-PCNA FRAP experiments shows that PCNA is stably associated to replication factories Essert et al Mol. Cell Biol. 25 :

19 19 There are about replication origins per chromosome Replication origins are recognized by specific protein complexes : ORC origin recognition complex) and MCM (minichromosome maintenance complex) Replication speed : bp/s The onset of DNA replication is triggered by « cell division cycle dependant kinases » (CDK) Replication starts at replication origins ORC : origin replication complex MCM : minichromosome maintenance complex Replisome 1. Activation 2. Extension 3. Termination 19

20 Les recombinaisons: modifications aléatoires et programmées du génome ADN1 + ADN2 ADN3 + ADN4 Mécanisme moléculaire de la recombinaison homologue La recombinaison de sites spécifiques La conjugaison, mécanisme de la parasexualité bactérienne La recombinaison VDJ, un des éléments de la diversité des anticorps et des TCR Le crossing-over durant la méiose accroît la diversité génomique de la population Les transposons et les virus, séquences dADN mobiles 20

21 homology cleavage ligation exchange displacement Holliday junction cleavage ligation The mechanism of homologuous recombination 21

22 ATP binding site ATP hydrolysis RecA proteins catalyze the exchange of DNA strands... Structure of a RecA polymer 22

23 … dans un seul sens without RecAwith RecA Driving force : ATP hydrolysis … in the 5 to 3 direction 23

24 Recombination events in cells Example CellsEffect Effector proteins Crossing-over Meiotic cells genomeRecA-D like ( germinal cells)rearrangementsproteins Virus integrationHost cell genomedormancyIntegrase lytic/lysogenicIntegration Host phasesFactor ConjugationBacteriagene exchangeIntegrase VDJ recombinationlymphocytesantibody and Rag1-2 TCR diversity Transposonsall cellsgenomeTransposases rearrangements 24

25 The two states of the bacteriophage Reversible recombination DNA of the bacterio phage DNA of E. coli attP attB Recombinant DNA Integrase Integration Host Factor Excisionase Integrase Integration Host Factor Example 1 : site-specific recombination of a virus 25

26 Integrase mechanism phage DNA E. Coli DNA attP attB recombinant DNA pairing, double cleavage, double exchange, ligation 26

27 Conformation 1 : phage and bacterial DNA separated Conformation 2 : phage and bacterial DNA fused attBattP bacterial DNA phage DNA 27

28 Biswas et al. (2005) A structural basis for allosteric control of DNA recombination by λ integrase Nature 435 : integration excision Phage integration in bacterial genome 28

29 Conjugation Reversible recombination « female » « male » DNA episome F factor F chromosome Hfr chromosome plasmide F integration excision F plasmids often carry virulence factors The F-factor allows gene exchange between bacteria 29

30 ampicilline R blasticidine R gène cible blasticidine R Recombinaison (double crossing-over) WT PHG1A phg1a phg1b phg1a/b PHG1B Anti-PHG1B Anti-PHG1A Benzhegal et al Applications de la recombinaison : invalidation de gène par insertion 30

31 Applications of recombination : the Cre-Lox system Cre recombinase : a P1 phage enzyme that catalyzes recombination between two LoxP sequences : LoxP : ATAACTTCGTATAGCATACATTATACGAAGTTAT Example : RIP-CreER transgenic mice have a tamoxifen inducible Cre-mediated recombination system driven by the rat insulin 2, Ins2, promoter. The transgene insert contains a fusion product involving Cre recombinase and a mutant form of the mouse estrogen receptor ligand binding domain. The mutant mouse estrogen receptor does not bind natural ligand at physiological concentrations but will bind the synthetic ligand, 4-hydroxytamoxifen. Restricted to the cytoplasm, the Cre/Esr1 protein can only gain access to the nuclear compartment after exposure to tamoxifen. When crossed with a strain containing a loxP site flanked sequence of interest, the offspring are useful for generating tamoxifen-induced, Cre-mediated targeted deletions. Tamoxifen administration induces Cre recombination in islet cells of the pancreas. About 100 loxP-flanked genes bearing strains are available at Jackson 31

32 Light chain of antibodies Example 2 : genetic rearrangements in B lymphocytes recombination RAG : recombination activating genes RSS : recombination signal sequences splicing 32

33 Transposons are mobile DNA sequences in genomes excisioninsertiontranscription traduction transposase example : Tn5 transposon and transposase 33

34 no specific insertion sites frequency of mobility: per generation Abundance variable in genomes (10% in drosophila, 40% in men) coat proteins use receptors to enter the cells type I transposons (retrotransposons) type II transposonsDNA viruses RNA viruses Viruses and transposons TransposonsViruses 34

35 Fast viruses Slow viruses Fast and slow viruses 35

36 The presence of transposons allows gene duplication, inversion or excision by homologous recombination DELETION INVERSION DUPLICATION 36

37 example of a diploid organism with 2 pairs of homologous chromosomes MITOSIS MEIOSIS FECUNDATION diploid 4 haploids gametes 2 diploids diploid 2 haploids Mitosis, meiosis and fecundation 37

38 DNA replication decondensation of chromosomes separation of daughter cells (cytokinesis) Chromosome condensation centromere s Sister chromatides separation of sister chromatides Mitotic spindle Mitosis : 1 diploid -> 2 diploids 38

39 DNA replication separation of homologous chromosomes gametes Chromosome condensation centromere Sister chromatids Pairing of homologous chromosomes synaptolemal complex 1 st mitosis 2 nd mitosis Meiosis : 1 diploid -> 4 haploids 39

40 « Crossing over » Transmission de l ADN mitochondial transmission presque exclusivement par la mère simple double séquences homologues fréquence : 1/10 7 paires de bases chromosome paternel chromosome maternel Epigénétique Certains gènes sont inactivés par méthylation, l état de méthylation peut être transmis aux cellules filles Exemple : inactivation d un des chromosomes X chez les femmes Transmission non-mendélienne 40

41 réplication de l ADN ségrégation des chromosomes homologues gamètes condensation des chromosomes centromère chromatides sœurs appariement des chromatides homologues et crossing-over Complexe synaptolemal 1 ière mitose 2 ième mitose Recombinaison durant la méiose 41

42 Chez E. coli, la recombinaison homologue a lieu à des sites spécifiques appelés « chi site » dont la séquence est GCTGGTGG, situés environ toutes les 4000 paires de base Chez E. coli, la recombinaison est catalysée par l action de quatres protéines RecA, RecB, RecC et RecD LADN simple brin est généré par l action d une hélicase et dune endonuclease du complexe RecBCD 42

43 DNA repair Molecular origin of DNA mutations General repair mechanisms The p53 protein controls DNA damage at a specific checkpoint of the eukaryote cell cycle 43

44 Sources of DNA damage Replication errors: DNA polymerasefrequency 1/10 7 Molecular damages to DNA: OriginDNA damage number/cell.dayPossible repair Exogenoussun (1h/day)T-T dimers Y chemicaladducts N (base modification) radioactivitysingle strand breaks Y (natural double strand breaks ?± background) Endogenoustemperature single strand breaks Y free radicalsadducts/breaks 10 4 Y metabolitesadducts 10 2 Y virusesgenome integration ?N transposons ?? 44

45 DNA repair mechanisms Damage typeRepair T-T dimers Adducts Single strand breaks Double strand breaks Restriction Excision Synthesis Ligation Excision Recombination Ligation or direct ligation Recognition 45

46 The COMET assay to measure DNA damages also called single cell gel electrophoresis (SCGE) 46

47 Ames test (Salmonella-his reversion-test ) for mutagenicity This experiment employed six strains of Salmonellatyphimurium histidine auxotroph mutants, deficient in the synthesis of histidine, an amino acid necessary for bacterial growth. The histidine auxotrophs will only grow in a medium containing sufficient histidine supplement. To revert to histidine production (prototrophy), or become his+,a reverse mutation must occur in the original his- mutation (found in one of the genes involving histidine biosynthesis). When plated onto an agar media containing a trace (1/1000 dilution) of histidine, only his+ revertants will grow to form a visible colony. The presence of visible colonies signifies a reverse mutation. Each of the six bacterial strains carries a different type of mutation (Table 1), making it possible to assess the type of mutation caused by the chemical under examination. When a chemical mutagen is introduced into the bacterial population on a filter disc, a higher number of revertants will appear, signalling the chemical causes genetic mutations. The Ames test includes using liver extract to simulate mammalian metabolic activity which may alter non-mutagenic chemicals to become mutagenic. The liver extract is generally obtained from rats treated with Aroclor 1254 to induce the presence of detoxifying enzymes. Brian Krug: Ames Test: Chemicals to Cancer Strain # S. typhimurium Type of Mutation Detected Strain Name 1 TA98 detect frame-shift mutations 2 TA100 detect base pair substitutions 3 TA102 detect excision repair 4 TA104 detect base-pair substitutions 5 TA1534 detect frame-shift mutation 6 TA1530 detect base pair substitutions Inhibition zone growth ring chemical to be tested 47

48 Exemple of repair : thymine dimers Tymine dimer repair enzyme : specific DNA endonuclease (induced by UV light) 48

49 benzo[a]pyrene (BP) Metabolism et carcinogenicity of Benzo[a]Pyrene benzo[a]pyrene-7,8-dihydrodiol -9,10-epoxide CYP1A1, CYP1A2 epoxide hydrolase the diol epoxide covalently binds to DNA (adduct) Increased DNA mutations & cancer Benzo[a]pyrene is a product of incomplete combustion at temperatures between 300 and 600 °C. aromatic molecule (L) Aryl hydrocarbon Receptor AhR AhR-L induction of specific mRNA (AhRE) AhR-L Growth Differentiation Metabolism (toxicity) P450 cytochromes (phase I) : CYP1A1, CYP1A2, CYP1B1, CYP2S1 Phase II enzymes : GST, UGT (detoxification mechanism) translocation to the nucleus AhRE 49

50 Shimizu et al. (2000) PNAS 97 : Benzo[a]pyrene carcinogenicity is lost in mice lacking the aryl hydrocarbon receptor Dossier INSERM Dioxines dans lenvironnement. Quels risques pour la santé ? Individual susceptibility to xenobiotics. Exemple of CYP genes 50

51 The rad genes in yeast A systematic study was conducted in yeast to identify genes responsible for the cell sensitivity to radiation 55 rad genes were found. Most of these genes have counterparts in the human genome. From current estimates, 240 genes are involved in DNA repair in humans 51

52 P Perego (2000) Yeast Mutants As a Model System for Identification of Determinants of Chemosensitivity. Pharmacol Rev 52: 477–491 52

53 Cell cycle checkpoints APOPTOSIS p53 APOPTOSIS Retinoblastoma protein (Rb) APOPTOSIS Anaphase Promoting Complex (APC) Apoptosis is an organized (programmed) cell death mechanism 53

54 Apoptosis Apoptosis is one form of programmed cell death, often observed in higher eukaryotes during development, selection of immune system cells, and cancer prevention by NKC Apoptosis can be triggered by intracellular processes, such as DNA damages, or by extracellular molecules, for instance activation of the Fas receptor by the Fas ligand, or the secretion of permeabilizing molecules by NKC. Apoptosis involves mitochondrial inactivation and the release of cytochrome c in the cytosol. The lack of ATP induces phosphatidyl serine exposure to the plasma membrane (the eat-me signal) and cell blebbing. Cell fragments are internalized by macrophages and digested. No inflammation (activation of the innate immune system) occurs. See movie 18.1 apoptosis 54

55 The p53 protein holds the cell cycle at the G1/S checkpoint in the presence of DNA damage p53 is a tetrameric 393 aa protein p53 consists of 3 domains : transcription activation domain DNA binding domain regulatory domain NLSphosphorylations The transcription activation domain interacts with the Mdm2 protein that triggers p53 degradation. The DNA binding domain interacts with a specific DNA sequence that controls p21 CIP expression The conformation and the localization of p53 is controlled by phosphorylation and acetylation acetylations p53 DNA binding domains in complex with DNA 55

56 TRANSCRIPTION of p21 inhibitor P cdk2 cycline E p21 p53 synthesisdegradation p53-P DNA polymerase ADNintactdamaged Chkinactiveactive p53absentbound to DNA (mdm2)(phosphorylated) p21repressedexpressed CDKactiveinactive CycleG1 SG1 stop p53-Ub Mdm2 + Double strand break Single strand break (30 to 40 bases lacking) Base mispairing Chk1/2 + Mdm2 = murine double minute oncogene Chk = checkpoint kinase p21= CIP (cdk2 inhibiting protein) = WAF1 (Wild Type p53-activated fragment) 56

57 p53 mutations are found in 50% of human cancers Arg248 Arg175, 249, 273, 282, Gly245 Mutation frequency Séquence primaire de p53 These mutations decrease p53 interaction with DNA, which eliminates the G1/S restriction point controlled by the Cdk2-cyclinE complex 57

58 4. Natural Killer Cells and cancer prevention Natural Killer Cells (NKC) are components of the (innate) immune systems. They are cytotoxic against tumor cells and cells infected by viruses. They also play an important role in graft rejection. NKC are sensitive to the molecules present at the surface of the cells. All cells in the body express MHC-I complexes that present fragments of endogenous proteins synthesized in the cell. Any change in the nature of MHC-I or in the surface concentration of MHC-I leads to NKC activation Upon activation, NKC bind to the target cell and locally release perforin and granzyme molecules at the plasma membrane of the target cell, which triggers apoptosis. In addition, NKC are able to recognize and kill cells with antibodies bound at their surface (adaptative immune system). Antibodies directed against surface antigens are indeed often present in cancers. Defects in NKC production severely increases the risk of cancer Tumor cells develop inhibitors that prevent NKC activation See movie 24.4 killer T cells 58

59 proteins DNA (desoxyribonucleic acid) mRNA (ribonucleic acid) Transcription factors DNA state sensors Repair enzymes Replication factors Apoptosis factors (mitochondrial inactivation, caspases) p53 CELL DIVISION CELL APOPTOSIS = CELL DEATH UNCONTROLLED CELL DIVISION = CANCER DNA repair mechanisms and cell fate Radiations DNA damage apoptosis Rapidly dividing cells are more sensitive to radiations 59

60 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) Indirect carcenogenicity of dioxin Dioxins occur as by-products in the manufacture of organochlorides, in the incineration of chlorine-containing substances such as PVC, in the bleaching of paper, and from natural sources such as volcanoes and forest fires. Dioxins build up primarily in fatty tissues over time. The major source of dioxins is food, especially from animals. TCDD has a half-life of approximately 8 years in humans. TCDD activates the AhR and thus induces CYP expression. This either increases or reduces carcinogenicity of other aromatic molecules such as Benzo[a]Pyrene and 7,12- dimethylbenz[a]anthracene, respectively. Travailleurs exposés aux phénoxy-herbicides et aux chlorophénols. Exposition : 3 à 389 pg/g de matières grasses Teneur du lait maternel en France : 16,5 ± 5 pg/g de matières grasses Dossier INSERM Dioxines dans lenvironnement. 60

61 22 paires de chromosomes autosomaux homologues C i p /C i m 2 chromosomes sexuels X m /Y p Père 22 paires de chromosomes autosomaux homologues C i p /C i m 2 chromosomes sexuels X m /X p Mère 22 chromosomes autosomaux C i p ou C i m 1 chromosome sexuel X m ou Y p spermatozoïdes 22 chromosomes autosomaux C i p ou C i m : 1 chromosome sexuel X m ou X p ovules 22 paires de chromosomes autosomaux homologues C i p ou C i m / C i p ou C i m 2 chromosomes sexuels X m ou Y p / X m ou X p Enfant 2 46 = possibilités Transmission des caractères parentaux chez l homme 61

62 Un gène génotype phenotype allèles lignées puresA/Aa/a F f A/a F A/Aa/aA/a F fF hybride de 1 ière génération hybrides de 2 de génération Deux gènes A/a B/bA/a B/b F G F G hybride de 1 ière génération B/BB/bb/b A/A FGFGFg A/a FGFGFg a/a fGfGfg B/BB/bb/b A/A 1/161/81/16 A/a 1/81/41/8 a/a 1/161/81/16 indépendants gènes portés par deux chromosomes différents (ou éloignés cf crossing-over) B/BB/bb/b A/A 1/400 A/a 01/20 a/a 001/4 liés gènes portés par le même chromosome AB/ab B/BB/bb/b A/A 1/4-2eee 2 A/a e1/2-2e 2 e a/a e 2 e 1/4-2e crossing-over e : fréquence de crossing-over, dépend de la distance entre les gènes (cMg :: e = 0.01) Génétique mathématique 62


Download ppt "Procaryotes : a single circular chromosome typically 5.10 6 base pairs eucaryotes : several linear chromosomes typically 3.10 9 base pairs 22 autosomal."

Similar presentations


Ads by Google