Presentation is loading. Please wait.

Presentation is loading. Please wait.

DNA is organized in chromosomes

Similar presentations


Presentation on theme: "DNA is organized in chromosomes"— Presentation transcript:

1 DNA is organized in chromosomes
procaryotes : a single circular chromosome typically base pairs eucaryotes : several linear chromosomes typically base pairs telomere 5 µm centromere 22 autosomal chromosome pairs Example : human genome + about hundred circular mitochondrial DNA molecules 2 sexual chromosomes 1

2 Structure and localization of chromosomes
Chromosomes are made of DNA and proteins (chromatin). Histones make DNA more compact and regulate its accessibility (nucleosomes). Transcription factors control gene expression. Replication factors catalyze DNA replication during the S phase of the cell cycle. Individual chromosomes can be observed during mitosis, one step of cell division (chromatin condensation). Centromeres are contact points between pairs of chromosomes. Telomeres are chromosome ends. A diploid (haploid) cell possesses 2 (1) set(s) of chromosomes

3 Regulation of DNA accessibility play a crucial role during transcription and replication
From ENCODE, an encyclopedy of DNA elements :

4 DNA replication 1 ADN  2 ADN DNA replication is semi-conservative
DNA polymerases Replication origins Assembly of the replication fork Further readings :

5 M. Meselson & P Stahl Proc. Nat. Ac. Sci. 1958
DNA replication is semi-conservative M. Meselson & P Stahl Proc. Nat. Ac. Sci. 1958

6 The cell cycle G0 Mitosis
In the resting state (G0), cells do not divide Gap 2 Gap 1 DNA Synthesis 6 6

7 Flow cytometry Fluorescence level
Up to 8 fluorophores can be simultaneously analyzed Forward and side scattering is used to analyze cell size and granularity Analysis rate ≈ cells/sec Several analysis in parallel

8 The Fluorescence Activated Cell Sorter (FACS)

9 DNA synthesis is catalyzed by DNA-dependent DNA polymerases
dATP PPi dTTP nucleotides PPi PPi PPi dCTP PPi PPi GGATC CCTAGGAATCTTGGAACCGGGCCC template dGTP GGATCCTTAGAACCTTGGCCCGGG CCTAGGAATCTTGGAACCGGGCCC primer 5’ 5’ DNA polymerization takes place in the 5’ to 3’ direction DNA polymerase requires a template and a primer dNTP template strand strand to be synthesized 9 Stryer et al. Biochemistry, Freeman Edt 9

10 DNA replication requires a primase to start
DNA replication is catalyzed by a DNA-dependant DNA polymerase in the 5 ’ to 3 ’ direction starting at double strand DNA or at a DNA-RNA hybrid A primase synthesize a RNA primer to initiate replication DNA polymerases are processive : processivity is the number of phosphodiester bonds that a single enzyme is able to catalyze before dissocation dNTP template strand strand to be synthesized

11 Leading and lagging strands
RNA primase Okazaki fragments Size of Okasaki fragments : eukaryotes 200 bp 11 Alberts et al. MBOC, Garland Edt 11

12 On the « leading strand », DNA is continuously synthesized
Replication fork primase NTP DNA helicase 3’ 5’ RNA primer DNAPol d DNA helicase dNTP 3’ 5’ 12 12

13 On the « lagging strand », DNA is synthesized discontinuously
Replication fork DNAPol a primase RNA primer NTP DNA helicase 5’ 3’ DNAPol e RNA primer dNTP DNA helicase 5’ 3’ RNAse and DNAPol e RNA primer dNTP DNA helicase 5’ 3’ ligase RNA primer DNA helicase 5’ 3’ 13 13

14 The core of the eukaryote replication complex
DNAPol d DNAPol a primase DNAPol e Movies 5.1 (Molecules and Complexes) and 5.4 (Cell functions) Mol. Biol. Cell Linda B. Bloom, University of Florida Eukaryote cells possesses several DNA polymerases (> 15) a nucleus 250 kDa DNA primase, lagging strand d nucleus 170 kDa leading strand e nucleus 260 kDa lagging strand, DNA repair 14 14

15 Main components of the DNA replication complex
The catalytic core DNA polymerase a – primase primer RNA synthesis DNA polymerase d, e DNA synthesis, leading+lagging strands Replication protein C* load PCNA on DNA Proliferating cell nuclear antigen (PCNA) sliding clamp ensuring processivity Topoisomerase Adjusts DNA supercoiling Helicase* Unwinds DNA into strands Replication protein A single strand DNA binding protein Flap endonuclease 1 removes RNA 5’-flap Dna2 RNase H1 removes RNA DNA ligase 1 joins Okasaki fragments * uses ATP The replisome Cyclin A, cyclin B1 Cyclin dependent kinase 1, 2 (CDK1, CDK2) + 11 other proteins… Temporal regulation Maga and Hübscher 1996 Biochemistry 35: Waga and Stillman 1994 Nature 269: Frouin et al EMBO reports 4: Hübscher and Yeon-Soo Seo 2001 Mol. Cells 12: 15 15

16 The central role of PCNA
PCNA (proliferating cell nuclear antigen) is a homotrimeric protein that helps DNA polymerase processivity in eukaryotic cells. During the S-phase, it assembles around DNA and form a DNA clamp. PCNA associates with RFC, DNA polymerases d and e, Fen1/Dna2, Lig1 (+ 15 other proteins !) PCNA is also involved in DNA repair mechanisms At 3’ OH end : RFC displaces Pol-a and loads PCNA + Pold/e At the flap structure : RFA dissociates Pole from PCNA PCNA recruits Fen1/Dna2 which cleaves the flap structure PCNA recruits Lig1 that joins the DNA fragments PDB 1AXC Maga and Hübscher 2003 Journal of Cell Science 116: 16 16

17 Replication is coordinated at replication factories
Visualization of DNA replication in living cells using GFP-PCNA FRAP experiments shows that PCNA is stably associated to replication factories GFP PCNA 17 Essert et al Mol. Cell Biol. 25 : 17

18 Replication is coordinated at replication factories
Visualization of DNA replication in living cells using GFP-PCNA FRAP experiments shows that PCNA is stably associated to replication factories 18 Essert et al Mol. Cell Biol. 25 : 18

19 Replication starts at replication origins
ORC : origin replication complex MCM : minichromosome maintenance complex Replisome Replication starts at replication origins 1. Activation 2. Extension 3. Termination There are about replication origins per chromosome Replication origins are recognized by specific protein complexes : ORC ‘origin recognition complex) and MCM (minichromosome maintenance complex) Replication speed : bp/s The onset of DNA replication is triggered by « cell division cycle dependant kinases » (CDK) 19 19

20 Les recombinaisons: modifications aléatoires et programmées du génome
ADN1 + ADN2  ADN3 + ADN4 Les recombinaisons: modifications aléatoires et programmées du génome Mécanisme moléculaire de la recombinaison homologue La recombinaison de sites spécifiques La conjugaison, mécanisme de la parasexualité bactérienne La recombinaison VDJ, un des éléments de la diversité des anticorps et des TCR Le crossing-over durant la méiose accroît la diversité génomique de la population Les transposons et les virus, séquences d’ADN mobiles

21 The mechanism of homologuous recombination
homology Holliday junction cleavage exchange cleavage ligation ligation displacement

22 RecA proteins catalyze the exchange of DNA strands ...
Structure of a RecA polymer ATP hydrolysis ATP binding site

23 … in the 5’ to 3’ direction … dans un seul sens without RecA with RecA
Driving force : ATP hydrolysis

24 Recombination events in cells
Example Cells Effect Effector proteins Crossing-over Meiotic cells genome RecA-D like ( germinal cells) rearrangements proteins Virus integration Host cell genome dormancy Integrase lytic/lysogenic Integration Host phases Factor Conjugation Bacteria gene exchange Integrase VDJ recombination lymphocytes antibody and Rag TCR diversity Transposons all cells genome Transposases rearrangements

25 Example 1 : site-specific recombination of a virus
The two states of the bacteriophage l Reversible recombination DNA of the bacterio phage l attP DNA of E. coli attB ExcisionaseIntegrase Integration Host Factor Integrase Integration Host Factor Recombinant DNA

26 Integrase mechanism pairing,
phage l DNA attP E. Coli DNA attB recombinant DNA pairing, double cleavage, double exchange, ligation

27 phage DNA attB attP bacterial DNA Conformation 1 : phage and bacterial DNA separated Conformation 2 : phage and bacterial DNA fused

28 integration Phage integration in bacterial genome excision Biswas et al. (2005) A structural basis for allosteric control of DNA recombination by λ integrase Nature 435 :

29 The F-factor allows gene exchange between bacteria
Conjugation Reversible recombination factor F « female » chromosome integration DNA Hfr chromosome excision « male » plasmide F ’ episome F F’ plasmids often carry virulence factors

30 Recombinaison (double crossing-over)
Applications de la recombinaison : invalidation de gène par insertion ampicillineR blasticidineR gène cible blasticidineR Recombinaison (double crossing-over) WT PHG1A Dphg1a Dphg1b Dphg1a/b PHG1B Anti-PHG1B Anti-PHG1A Benzhegal et al. 2002

31 Applications of recombination : the Cre-Lox system
Cre recombinase : a P1 phage enzyme that catalyzes recombination between two LoxP sequences : LoxP : ATAACTTCGTATAGCATACATTATACGAAGTTAT Example : RIP-CreER transgenic mice have a tamoxifen inducible Cre-mediated recombination system driven by the rat insulin 2, Ins2, promoter. The transgene insert contains a fusion product involving Cre recombinase and a mutant form of the mouse estrogen receptor ligand binding domain. The mutant mouse estrogen receptor does not bind natural ligand at physiological concentrations but will bind the synthetic ligand, 4-hydroxytamoxifen. Restricted to the cytoplasm, the Cre/Esr1 protein can only gain access to the nuclear compartment after exposure to tamoxifen. When crossed with a strain containing a loxP site flanked sequence of interest, the offspring are useful for generating tamoxifen-induced, Cre-mediated targeted deletions. Tamoxifen administration induces Cre recombination in islet cells of the pancreas. About 100 loxP-flanked genes bearing strains are available at Jackson

32 Example 2 : genetic rearrangements in B lymphocytes
Light chain k of antibodies recombination splicing RAG : recombination activating genes RSS : recombination signal sequences

33 Transposons are mobile DNA sequences in genomes
transposase transcription traduction excision insertion example : Tn5 transposon and transposase

34 Viruses and transposons
no specific insertion sites frequency of mobility: 10-6 per generation Abundance variable in genomes (10% in drosophila, 40% in men) coat proteins use receptors to enter the cells type I transposons (retrotransposons) RNA viruses type II transposons DNA viruses

35 Fast and slow viruses Fast viruses Slow viruses

36 The presence of transposons allows gene duplication, inversion or excision by homologous recombination DELETION INVERSION DUPLICATION

37 Mitosis, meiosis and fecundation
example of a diploid organism with 2 pairs of homologous chromosomes diploid gametes diploid 2 haploids 2 diploids diploid 4 haploids MITOSIS FECUNDATION MEIOSIS

38 Mitosis : 1 diploid -> 2 diploids
separation of sister chromatides Mitotic spindle DNA replication decondensation of chromosomes Chromosome condensation centromeres Sister chromatides separation of daughter cells (cytokinesis)

39 Pairing of homologous chromosomes separation of homologous chromosomes
Meiosis : 1 diploid -> 4 haploids synaptolemalcomplex Pairing of homologous chromosomes DNA replication 1st mitosis separation of homologous chromosomes Chromosome condensation centromere Sister chromatids 2nd mitosis gametes

40 Transmission de l ’ADN mitochondial
Transmission non-mendélienne « Crossing over » séquences homologues fréquence : 1/107 paires de bases chromosome paternel chromosome maternel simple double Transmission de l ’ADN mitochondial transmission presque exclusivement par la mère Epigénétique Certains gènes sont inactivés par méthylation, l ’état de méthylation peut être transmis aux cellules filles Exemple : inactivation d ’un des chromosomes X chez les femmes

41 Recombinaison durant la méiose
Complexe synaptolemal appariement des chromatides homologues et crossing-over réplication de l ’ADN 1ière mitose ségrégation des chromosomes homologues condensation des chromosomes centromère chromatides sœurs 2ième mitose gamètes

42 L’ADN simple brin est généré par l ’action d ’une hélicase et d’une endonuclease du complexe RecBCD
Chez E. coli, la recombinaison homologue a lieu à des sites spécifiques appelés « chi site » dont la séquence est GCTGGTGG, situés environ toutes les 4000 paires de base Chez E. coli, la recombinaison est catalysée par l ’action de quatres protéines RecA, RecB, RecC et RecD

43 DNA repair Molecular origin of DNA mutations General repair mechanisms
The p53 protein controls DNA damage at a specific checkpoint of the eukaryote cell cycle

44 Sources of DNA damage Replication errors: DNA polymerase frequency 1/107 Molecular damages to DNA: Origin DNA damage number/cell.day Possible repair Exogenous sun (1h/day) T-T dimers Y chemical adducts N (base modification) radioactivity single strand breaks Y (natural double strand breaks ? ± background) Endogenous temperature single strand breaks Y free radicals adducts/breaks Y metabolites adducts Y viruses genome integration ? N transposons ? ? 44

45 DNA repair mechanisms Damage type Repair Recognition T-T dimers
Adducts Single strand breaks Double strand breaks Restriction Excision Synthesis Ligation Excision or direct ligation Recombination Ligation 45

46 The COMET assay to measure DNA damages
also called single cell gel electrophoresis (SCGE) 46

47 Ames test (Salmonella-his reversion-test ) for mutagenicity
This experiment employed six strains of Salmonellatyphimurium histidine auxotroph mutants, deficient in the synthesis of histidine, an amino acid necessary for bacterial growth. The histidine auxotrophs will only grow in a medium containing sufficient histidine supplement. To revert to histidine production (prototrophy), or become his+,a reverse mutation must occur in the original his- mutation (found in one of the genes involving histidine biosynthesis). When plated onto an agar media containing a trace (1/1000 dilution) of histidine, only his+ revertants will grow to form a visible colony. The presence of visible colonies signifies a reverse mutation. Each of the six bacterial strains carries a different type of mutation (Table 1), making it possible to assess the type of mutation caused by the chemical under examination. When a chemical mutagen is introduced into the bacterial population on a filter disc, a higher number of revertants will appear, signalling the chemical causes genetic mutations. The Ames test includes using liver extract to simulate mammalian metabolic activity which may alter non-mutagenic chemicals to become mutagenic. The liver extract is generally obtained from rats treated with Aroclor 1254 to induce the presence of detoxifying enzymes. Brian Krug: Ames Test: Chemicals to Cancer chemical to be tested Inhibition zone growth ring Strain # S. typhimurium Type of Mutation Detected Strain Name 1 TA98 detect frame-shift mutations 2 TA100 detect base pair substitutions 3 TA102 detect excision repair 4 TA104 detect base-pair substitutions 5 TA1534 detect frame-shift mutation 6 TA1530 detect base pair substitutions

48 Exemple of repair : thymine dimers
(induced by UV light) Tymine dimer repair enzyme : specific DNA endonuclease 48

49 Metabolism et carcinogenicity of Benzo[a]Pyrene
aromatic molecule (L) Aryl hydrocarbon Receptor AhR AhR-L induction of specific mRNA (AhRE) Growth Differentiation Metabolism (toxicity) P450 cytochromes (phase I) : CYP1A1, CYP1A2, CYP1B1, CYP2S1 Phase II enzymes : GST, UGT (detoxification mechanism) translocation to the nucleus AhRE Benzo[a]pyrene is a product of incomplete combustion at temperatures between 300 and 600 °C. benzo[a]pyrene (BP) benzo[a]pyrene-7,8-dihydrodiol -9,10-epoxide CYP1A1, CYP1A2 epoxide hydrolase the diol epoxide covalently binds to DNA (adduct) Increased DNA mutations & cancer 49

50 Individual susceptibility to xenobiotics. Exemple of CYP genes
Shimizu et al. (2000) PNAS 97 : Benzo[a]pyrene carcinogenicity is lost in mice lacking the aryl hydrocarbon receptor Dossier INSERM Dioxines dans l’environnement. Quels risques pour la santé ? Individual susceptibility to xenobiotics. Exemple of CYP genes 50

51 The rad genes in yeast A systematic study was conducted in yeast to identify genes responsible for the cell sensitivity to radiation  55 “rad” genes were found. Most of these genes have counterparts in the human genome. From current estimates, 240 genes are involved in DNA repair in humans 51

52 P Perego (2000) Yeast Mutants As a Model System for Identification of Determinants of Chemosensitivity. Pharmacol Rev 52: 477–491 52

53 Cell cycle checkpoints
APOPTOSIS Retinoblastoma protein (Rb) APOPTOSIS Anaphase Promoting Complex (APC) APOPTOSIS p53 Apoptosis is an organized (programmed) cell death mechanism 53

54 Apoptosis Apoptosis is one form of programmed cell death, often observed in higher eukaryotes during development, selection of immune system cells, and cancer prevention by NKC Apoptosis can be triggered by intracellular processes, such as DNA damages, or by extracellular molecules, for instance activation of the Fas receptor by the Fas ligand, or the secretion of permeabilizing molecules by NKC. Apoptosis involves mitochondrial inactivation and the release of cytochrome c in the cytosol. The lack of ATP induces phosphatidyl serine exposure to the plasma membrane (the “eat-me” signal) and cell blebbing. Cell fragments are internalized by macrophages and digested. No inflammation (activation of the innate immune system) occurs . See movie 18.1 apoptosis 54

55 The p53 protein holds the cell cycle at the G1/S checkpoint in the presence of DNA damage
p53 is a tetrameric 393 aa protein p53 consists of 3 domains : 1 100 200 300 393 phosphorylations NLS acetylations transcription activation domain DNA binding domain regulatory domain The transcription activation domain interacts with the Mdm2 protein that triggers p53 degradation. The DNA binding domain interacts with a specific DNA sequence that controls p21CIP expression The conformation and the localization of p53 is controlled by phosphorylation and acetylation p53 DNA binding domains in complex with DNA 55

56 TRANSCRIPTION of p21 inhibitor
ADN intact damaged Chk inactive active p53 absent bound to DNA (mdm2) (phosphorylated) p21 repressed expressed CDK active inactive Cycle G1S G1 stop Mdm2 synthesis p53 p53-Ub degradation + Chk1/2 + DNA polymerase p53-P TRANSCRIPTION of p21 inhibitor Double strand break Single strand break (30 to 40 bases lacking) cycline E Base mispairing p21 cdk2 P Mdm2 = murine double minute oncogene Chk = checkpoint kinase p21= CIP (cdk2 inhibiting protein) = WAF1 (Wild Type p53-activated fragment) 56

57 p53 mutations are found in 50% of human cancers
Arg175, 249, 273, 282, Gly245 Arg248 Mutation frequency Séquence primaire de p53 These mutations decrease p53 interaction with DNA, which eliminates the G1/S restriction point controlled by the Cdk2-cyclinE complex 57

58 4. Natural Killer Cells and cancer prevention
Natural Killer Cells (NKC) are components of the (innate) immune systems. They are cytotoxic against tumor cells and cells infected by viruses. They also play an important role in graft rejection. NKC are sensitive to the molecules present at the surface of the cells. All cells in the body express MHC-I complexes that present fragments of endogenous proteins synthesized in the cell. Any change in the nature of MHC-I or in the surface concentration of MHC-I leads to NKC activation Upon activation, NKC bind to the target cell and locally release perforin and granzyme molecules at the plasma membrane of the target cell, which triggers apoptosis. In addition, NKC are able to recognize and kill cells with antibodies bound at their surface (adaptative immune system). Antibodies directed against surface antigens are indeed often present in cancers. Defects in NKC production severely increases the risk of cancer Tumor cells develop inhibitors that prevent NKC activation See movie 24.4 killer T cells 58

59 DNA repair mechanisms and cell fate
DNA (desoxyribonucleic acid) mRNA (ribonucleic acid) UNCONTROLLED CELL DIVISION = CANCER proteins Repair enzymes Transcription factors CELL DIVISION DNA state sensors Replication factors Apoptosis factors (mitochondrial inactivation, caspases) CELL APOPTOSIS = CELL DEATH p53 Radiations  DNA damage  apoptosis Rapidly dividing cells are more sensitive to radiations 59

60 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)
Indirect carcenogenicity of dioxin 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) Travailleurs exposés aux phénoxy-herbicides et aux chlorophénols. Exposition : 3 à 389 pg/g de matières grasses Teneur du lait maternel en France : 16,5 ± 5 pg/g de matières grasses Dossier INSERM Dioxines dans l’environnement. Dioxins occur as by-products in the manufacture of organochlorides, in the incineration of chlorine-containing substances such as PVC, in the bleaching of paper, and from natural sources such as volcanoes and forest fires. Dioxins build up primarily in fatty tissues over time. The major source of dioxins is food, especially from animals. TCDD has a half-life of approximately 8 years in humans. TCDD activates the AhR and thus induces CYP expression. This either increases or reduces carcinogenicity of other aromatic molecules such as Benzo[a]Pyrene and 7,12-dimethylbenz[a]anthracene, respectively.

61 Transmission des caractères parentaux chez l ’homme
22 paires de chromosomes autosomaux homologues Cip/Cim 2 chromosomes sexuels Xm/Yp Père 22 paires de chromosomes autosomaux homologues Cip/Cim 2 chromosomes sexuels Xm/Xp Mère 22 chromosomes autosomaux Cip ou Cim 1 chromosome sexuel Xm ou Yp spermatozoïdes 22 chromosomes autosomaux Cip ou Cim : 1 chromosome sexuel Xm ou Xp ovules 22 paires de chromosomes autosomaux homologues Cip ou Cim / Cip ou Cim 2 chromosomes sexuels Xm ou Yp/ Xm ou Xp Enfant 246 = 1013 possibilités

62 Génétique mathématique
Un gène génotype phenotype allèles lignées pures A/A a/a F f A/a A/a F F A/A a/a A/a F f F hybride de 1ière génération hybrides de 2de génération Deux gènes A/a B/b A/a B/b F G F G hybride de 1ière génération B/B B/b b/b A/A FG FG Fg A/a FG FG Fg a/a fG fG fg B/B B/b b/b A/A 1/16 1/8 1/16 A/a 1/8 1/4 1/8 a/a 1/16 1/8 1/16 indépendants gènes portés par deux chromosomes différents (ou éloignés cf crossing-over) B/B B/b b/b A/A 1/4-2e e e2 A/a e 1/2-2e2 e a/a e2 e 1/4-2e crossing-over e : fréquence de crossing-over, dépend de la distance entre les gènes (cMg :: e = 0.01) B/B B/b b/b A/A 1/4 0 0 A/a 0 1/2 0 a/a 0 0 1/4 liés gènes portés par le même chromosome AB/ab


Download ppt "DNA is organized in chromosomes"

Similar presentations


Ads by Google