Presentation is loading. Please wait.

Presentation is loading. Please wait.

DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:

Similar presentations


Presentation on theme: "DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:"— Presentation transcript:

1 DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department: Environmental & Molecular Toxicology Oregon State University

2 Colorectal Cancer (CRC) 2 nd leading cause of cancer deaths worldwide CRC claims nearly 50,000 lives/year in U.S. American Cancer Society estimates 147,000 new cases by 2011

3 Lynch Syndrome (HNPCC) Autosomal dominant genetic condition Mutation in one or more of the 4 MMR genes: MLH1 & PMS2 (MutLα) and MSH2 & MSH6 (MutSα) MSH2 MSH6/ 3 PMS2 MLH1

4 Mismatch Repair Apoptosis A number of cellular pathways, processes and environmental genotoxins interact to influence an individuals susceptibility and risk for developing cancer.

5 Recognition of Mismatch MSH2 MSH6/ 3 ATP ADP DNA replication error rate = 1 mispairing / basepairs MutS heterodimer locates and binds mismatch MutL heterodimer recruited and endonuclease activated MSH2 MSH6/ 3 PMS2 MLH1

6 Excision of Mismatch MSH2 MSH6/ 3 PMS2 MLH1 RPA hEXO1 RPA (Replication Protein A) Binds ssDNA, prevents degradation, promotes Polymerase δ, Exonuclease1 Activity: 5 3 directed

7 Correction of Mismatch c c RPA Pol δ/ε RFC PCNA DNA Ligase Nick PCNA = Proliferating Cell Nuclear Antigen RFC = Replication Factor C Pol δ/ε = DNA Polymerase Delta/Epsilon

8 Mutator Phenotype Mutations are a driving force behind cancer development Mutated MMR genes MLH1 Aberrant MMR proteins Replication errors bypass defective MMR systems Mutations inactivate tumor suppressor genes and enable onco-genes (APC gene) Enhanced proliferation Mutated cells divide unchecked growth loss of apoptotic ability acquisition of metastic ability resistance to chemotherapeutic agents (6-TG, MNNG, 5-FU)

9 PAHs – The Environmental Influence Mutagenic and carcinogenic - large nonpolar compounds Exposure: diet, smoking, grilling food, fossil fuel processing Metabolized forming highly reactive diol epoxides (DE) Benzo[a]pyrene is metabolically activated to benzo[a]pyrene diol epoxide (BPDE) which binds to DNA forming bulky DNA adducts

10 Big Question Global Hypothesis Specific combinations of environmental exposures and cellular deficiencies interact to influence cancer risk in individuals Specific Hypothesis MMR is a key pathway for reducing deleterious consequences (mutations) from PAH exposure Prediction Cells lacking MMR will show increased PAH-induced mutation

11 3 Questions: 1.) General phenomena of MMR-deficiency? 2.) What are the extra mutations induced? 3.) General phenomena of PAHs, in complex mixtures?

12 Hypothesis We hypothesize that results seen with HCT 116 lines do reflect differences in MMR status rather than other potential known or unknown differences in the cell lines. -Verify using DLD1 cell lines proficient and deficient in MSH6 We hypothesize that MMR-dependent suppression of BPDE-induced mutations represent a phenomenon generalizable to other PAHs, including environmentally relevant complex mixtures.

13 BPDE-Induced Mutation Forward mutations induced by exposure to PAHs are measured using the reporter gene hypoxanthine-guanine phosphoribosyl transferase (HPRT) 657bp HAT media – 5 passages 1 hour BPDE exposure Doses: 0, 25, 50, 100 nM Bulky PAH-DNA adducts Gene HPRT- Protein HPRT+/- Grown 8 days to insure no HPRT+ protein present HPRT+ HPRT- Clear pre-existing mutants HPRT- mutant cells survive in 6-Thioguanine selective media HPRT+ HPRT-

14 Cell Lines HCT Ch3 WT MLH1+ HCT Ch2 MLH1- MMR ProficientMMR Deficient WT MSH6+ MSH6- DLD1+Ch2DLD1

15 Mutant Frequency Calculation MF=6-TG resistant colonies formed/(PE x # of plates) MF=mutant frequency PE = plating efficiency MMR Proficient MLH1 MMR Deficient MLH1 135,000 cells300 cells 6-TG selective media Non-selective media 135,000 cells300 cells 6-TG selective media Non-selective media few colonies ~150 colonies more colonies ~150 colonies

16 Results: PAH-induced mutation in MSH6- deficient cells, similar to previous MMR+ proficient cells Technical issue with low plating efficiency in MSH6+

17 v Mutation Identification trypsinized cloning disc Total RNA Purification Centrifuge

18 agarose gel electrophoresis RNA cDNA PCR sequence Primers P3: -36 to CCTGAGCAGTCAGCCCGCGC 3 P4: 701 to CAATAGGACTCCAGATGTTT 3 Reverse Transcriptase - PCR cDNA PCR – amplify HPRT gene Sequencing

19 Agarose Gel Electrophoresis Mutant: CONTROLS Batch 3 PCR Products – HCT HPRT Mutants HPRT product 657bp

20 Spectrum of HPRT Mutations Deletion of one nucleotide base AT GC transition Insertion of one nucleotide base GC CG transversion GC TA transversion GC AT transition Spectrum Key 58.3% 12.5% 25.0% 4.2%

21 Conclusion Preliminary data suggest: BPDE-induced spectra in MLH1 deficient cells different from spontaneous mutations Too soon to tell if induced spectra differs in MMR proficient vs. deficient cell lines

22 Future Investigations Continue mutant analysis on remaining clones: HCT 116+Ch2 HCT 116+Ch3 DLD1 DLD1+Ch2 Complex environmental mixtures Mutant frequency Individual mutation analysis

23 Goals Research Goals & Significance Understand MMR functions as well as genetic influences and their combined role in normal responses to carcinogens Accurate evaluation of an individuals susceptibility and risk to developing CRC Provide insight for more effective and practical CRC screening methods Develop novel models for studying other genetic and environmentally linked diseases

24 Acknowledgements Howard Hughes Medical Institute Environmental Health Sciences Center Dr. Andrew Buermeyer – Jacki Coburn – Fatimah Almousawi – Kimberly Sarver Dr. Vidya Schalk Dr. Kevin Ahern, program coordinator


Download ppt "DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department:"

Similar presentations


Ads by Google