Presentation is loading. Please wait.

Presentation is loading. Please wait.

1 Origin of Man and the Races Richard Deem, M.S. Reasons To Believe.

Similar presentations


Presentation on theme: "1 Origin of Man and the Races Richard Deem, M.S. Reasons To Believe."— Presentation transcript:

1 1 Origin of Man and the Races Richard Deem, M.S. Reasons To Believe

2 2 General Outline Biblical data and scientific data Origin of man Molecular and genetic data – mtDNA and Y chromosome mtDNA Mitochondrial DNA – A small piece of DNA that codes for a small number of proteins within the energy-producing sub-cellular organelle known as the mitochondrion mtDNA Mitochondrial DNA – A small piece of DNA that codes for a small number of proteins within the energy-producing sub-cellular organelle known as the mitochondrion Neandertals and humans Bipedal primates and chimpanzees Origin of the races

3 3 Why All the Biology? And to the Jews I became as a Jew, that I might win Jews; to those who are under the Law, as under the Law, though not being myself under the Law, that I might win those who are under the Law; to those who are without law, as without law, though not being without the law of God but under the law of Christ, that I might win those who are without law. To the weak I became weak, that I might win the weak; I have become all things to all men, that I may by all means save some. (1 Corinthians 9:20-22)

4 4 Origin of Man Classic Hypothesis Neandertals H. antecessor H. ergaster European Humans African Humans Asian Humans

5 5 Origins of Mammals Soulish (nephesh) creatures created on days 5 and 6 Creation of specific mammals (cattle, rodents, and carnivores) described for day 6. Though not specifically mentioned, probably included the creation of bipedal primates Nephesh The Hebrew word most often translated soul, referring to both man and animals, including mind, will, and emotion Nephesh The Hebrew word most often translated soul, referring to both man and animals, including mind, will, and emotion

6 6 Origin of Man – Biblical Data Genesis 1:26 Then God said, Let us make (asah) man in our image, in our likeness…

7 7 Origin of Man – Biblical Data Genesis 1:27 So God created (bara) man in his own image, in the image of God he created (bara) him: male and female he created (bara) them.

8 8 Origin of Man – Biblical Data Genesis 2:7 Then the LORD God formed (yatsar) man of dust from the ground, and breathed into his nostrils the breath of life; and man became a living being. (Genesis 2:7)

9 9 Man – Part New, Part Old Bara – created new, probably refers to the spiritual qualities, self-awareness, moral understanding Asa, yatsar – made or formed from pre-existing material, probably refers to body and soul

10 10 Genesis 2:10, 14 Now a river flowed out of Eden to water the garden; and from there it divided and became four rivers. Biblical Data – Garden of Eden And the name of the third river is Tigris; it flows east of Assyria. And the fourth river is the Euphrates.

11 11 Origin of Man – Biblical Data Adequate, but incomplete genealogies Ben and ab ~10, ,000 years ago Dating human origins:

12 12 Incomplete Genealogies Matthew 1:81 Chronicles 3:10-12 and to Asa was born Jehoshaphat; and to Jehoshaphat, Joram; and to Joram, Uzziah; Asa his son, Jehoshaphat his son, Jehoram his son, Ahaziah his son, Joash his son, Amaziah his son, Azariah [Uzziah] his son

13 13 Incomplete Genealogies Genesis 5-11Luke 3:34-36 (reversed order) And Lamech… father of a son… Noah, (Genesis 5:28- 29)... became the father of Shem. (Genesis 5:32)... The sons of Shem: Elam, Asshur, Arphaxad, Lud and Aram. (Genesis 10:22)... Arphaxad was the father of Shelah, and Shelah the father of Eber. Two sons were born to Eber: One was named Peleg (Genesis 10:24-25) the son of Serug, the son of Reu, the son of Peleg, the son of Heber, the son of Shelah, (Luke 3:35) the son of Cainan, the son of Arphaxad, the son of Shem, the son of Noah, the son of Lamech, (Luke 3:36)

14 14 Direct Descent? ben – son, grandson, etc. ab – father, grandfather Harris, R.L., G.L. Archer, and B.K. Wilke Theological Wordbook of the Old Testament, Vol. 1. Moody Press, Chicago, IL, pp. 5-6,

15 15 Direct Descent? NASBAlternate Translation And Enosh lived ninety years, and became the father of Kenan. (Genesis 5:9) And Enosh lived ninety years, and became the father of the family line that culminated with Kenan. (Genesis 5:9)

16 16 How Many Generations? Deuteronomy 7:9 1 Chronicles 16:15 Psalms 105:8 He has remembered His covenant forever, The word which He commanded to a thousand generations, (Psalms 105:8) 1,000 gen x 40 yr/gen = 40,000 yr

17 17 Scientific Predictions for the Origin of Humans Creation Model

18 18 Scientific Predictions Anatomical – basic body plan Physiological – the way the body works Biochemical – the chemical pathways and machines that underlie everything Similarities with Other Animals

19 19 Scientific Predictions Sudden appearance… Human fossils Human culture Spiritual activity

20 20 Scientific Predictions Origin of man: Traceable to a single man and a single woman Recent origin

21 21 Origin of man: Scientific Predictions All males directly related to Noah All females directly related to Eve Females should be more genetically diverse

22 22 Scientific Data for Human Origins

23 23 Molecular Anthropology Similarities and differences Extent of differences Compare DNA sequences among modern human groups

24 24 Gives Molecular Anthropology Date of humanitys origin Original population size

25 25 Molecular Anthropology Gives Pattern for humanitys spread Geographic location of humanitys origin

26 26 Genetic Diversity Evidence Mitochondrial DNA Y chromosomal DNA Linkage disequilibrium Microsatellites Mitochondrial DNA (mtDNA) Male sperm contribute only genetic material and no cellular organelles. Therefore, all mtDNA comes from the egg, being passed down exclusively by females. Mitochondrial DNA (mtDNA) Male sperm contribute only genetic material and no cellular organelles. Therefore, all mtDNA comes from the egg, being passed down exclusively by females. Y chromosome A small chromosome that determines the sex of an individual. Embryos that posses a Y chromosome become male. Therefore, the genetic information on the Y chromosome is passed down only by males. Y chromosome A small chromosome that determines the sex of an individual. Embryos that posses a Y chromosome become male. Therefore, the genetic information on the Y chromosome is passed down only by males. Linkage disequilibrium The non-random association of alleles at different loci (or regions within DNA sequences), not expected from the law of independent assortment. Linkage disequilibrium The non-random association of alleles at different loci (or regions within DNA sequences), not expected from the law of independent assortment. Microsatellites Microsatellites" are loci where short sequences of DNA are repeated in tandem arrays (one right after the other). Microsatellites Microsatellites" are loci where short sequences of DNA are repeated in tandem arrays (one right after the other).

27 27 Genetic Diversity Humanity had a recent origin African origin Small population that rapidly expanded recently

28 28 Human Chromosome 21 Diversity Three haplotypes describe 80% of human population Haplotype A combination of alleles (alternate forms of the same gene) of closely linked loci that are found in a single chromosome and tend to be inherited together Haplotype A combination of alleles (alternate forms of the same gene) of closely linked loci that are found in a single chromosome and tend to be inherited together Far fewer haplotypes than expected

29 29 Mitochondrial DNA Humanity originated less than 150,000 ya Small population of women Single location (Africa)

30 30 Y Chromosome Mapping Testis Determining Factor (TDF) Channel Surfing (SRF) Addiction to death and destruction movies (T-2) The need to always be right (TLD-U) Spitting and hacking (P2E) Inability to express affection (ME-2) Finding humor in bodily noises (BLCH) Inability to put toilet seat down (BIDET) Selective hearing loss (MUM) Inability to ask directions (LST) Ability to write name with urine (CMeP)

31 31 Y Chromosome Data Study Total Base Pairs 95% CI Mean Pop. Size LowerUpper Dorit, et al. 27, ,000270,0007,500 Hammer39,00051,000411,000188,0005,000 Whitfield, et al. 91,50037,00049,00043,000N/A CI (Confidence Interval) A statistical measure of the certainty of a value. 95% CI means that there is a 95% probability that the result lies between the CI values. CI (Confidence Interval) A statistical measure of the certainty of a value. 95% CI means that there is a 95% probability that the result lies between the CI values.

32 32 Male vs. Female Divergence Age of Coalescence Y (Male) mtDNA (Female) Minimum37,000120,000 Maximum49,000474,000 Whitfield, L.S., J.E. Suston, and P.N. Goodfellow Sequence variation of the human Y chromosome. Nature 378:

33 33 Y Chromosome Summary Humanity originated less than 50,000 ya Small population of men Single location (Africa)

34 34 Linkage Disequilibrium Humanity originated less than 50,000 ya

35 35 Origin of the Malaria Parasite Originated less than 120,000 ya Resistance alleles appeared 3,000-12,000 ya

36 36 Scientific Data Sudden appearance of modern humans in the fossil record Time (MYA) Australopithecines Homo Cranial Capacity (cc)

37 37 Scientific Data Sophisticated tool kit Socioeconomic organization Art work Spiritual expression Sudden appearance of human culture:

38 38 Sophisticated Tool Kit A shift from predominantly rake to blade stone tool technology Increased variety and complexity of stone tools involving a higher degree of imposed form Complex and extensively shaped bone, antler, and ivory artifacts Increased regional diversification of tool forms

39 39 Socioeconomic Organization Specialized patterns of animal exploitation, based on systematic hunting A sharp increase in the overall density of human population An increase in the maximum size of local residential groups Appearance of highly structured sites, including hearths, pits, huts, tents, and other habitations

40 40 Appearance of Modern Art

41 41 Body Ornaments Dated at 40,000 years ago No food value Unusual designs and color

42 42 Spiritual Expression Religious relics and altars date to 24,000 ya Artwork containing spiritual content dates to 5,000 ya

43 43 Deleterious Mutations "The deleterious mutation rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if mutational effects on fitness were to combine in a multiplicative way." MutationsOverallDeleterious Conservative Realistic Eyre-Walker, A. & Keightley, P. D High genomic deleterious mutation rates in hominids. Nature 397,

44 44 Pseudogenes present in great apes and humans Pseudogenes Regions of non-coding DNA (DNA that does not code for functional protein) that have been apparently duplicated from functional genes. Pseudogenes Regions of non-coding DNA (DNA that does not code for functional protein) that have been apparently duplicated from functional genes. Beta globin Enolase Vitamin C Assumes that God would never reuse previous designs Evidence Against the Design of Humans?

45 45 Summary - Scientific Data Humans originated from a small population of males and females Recent origin of modern humans ~ 50,000 years ago Humans originated suddenly and dramatically

46 46 Origin of Man Out-of-Africa Hypothesis H. ergaster African Humans European Humans Asian Humans Neandertals H. antecessor ? ? ?

47 47 Who were the Neandertals?

48 48 Lived ~150,000 to ~30,000 years agoLived ~150,000 to ~30,000 years ago Inhabited Europe and western AsiaInhabited Europe and western Asia Lived ~150,000 to ~30,000 years agoLived ~150,000 to ~30,000 years ago Inhabited Europe and western AsiaInhabited Europe and western Asia Who Were the Neandertals?

49 49 Who Were the Neandertals? Bipedal Physical similarities with modern humans Bipedal (bipedalism) Ability to walk upright on two legs. Bipedal (bipedalism) Ability to walk upright on two legs. Large brain capacity

50 50 Physical Differences Between Neandertals and Humans Large front teeth Brow ridge Receding forehead Modern Human Neandertal Brain shape Occipital bun Retromolar gap Large eye sockets Chin receding Modern Human Neandertal

51 51 Physical Differences Between Neandertals and Humans Elongated foramen magnum Pterygoid tubercle A small rounded nodule on the Pterygoid bone in the roof of the mouth connecting the palatine in front and the quadrate behind. Pterygoid tubercle A small rounded nodule on the Pterygoid bone in the roof of the mouth connecting the palatine in front and the quadrate behind. Foramen magnum The area where the spine joins the skull Foramen magnum The area where the spine joins the skull Medial pterygoid tubercle Flatter skull base

52 52 Physical Differences Between Neandertals and Humans Large nose Large sinuses Structure of the inner ear Chimp Neander. Human Higher larynx

53 53 Physical Differences Between Neandertals and Humans Thicker bones Barrel chests Shorter limbs Asymmetrical humerus Metacarpals The bones that connect the wrist bones (carpals) with the finger bones (phalanges). Metacarpals The bones that connect the wrist bones (carpals) with the finger bones (phalanges). Thicker metacarpals

54 54 Neandertal Development Craniodental development of Neandertals and humans differs from before birth Craniodental A fancy word referring to the skull and teeth Craniodental A fancy word referring to the skull and teeth Differences occur from the time Neandertals first appear

55 55 Molecular Paleontology: Neandertal mtDNA 40,000 YA Neander, Germany 40,000 YA Vindija Cave, Croatia Vindija Cave, Croatia 29,000 YA Northern Caucasus Northern Caucasus

56 56 DNA 101 DNA language: 4 letters in the alphabet A – AdenineT – Thymine C – CytosineG – Guanine 20 3-letter words (codons) Each codon codes for one amino acid Unlimited number of sentences (proteins) Unlimited number of novels (organism)

57 57 Neandertal mtDNA mtDNA Sample (HVR-1) Sequence Number (Read Down) Mod. HumanAATTCCCCGACTGCAATTCACGCAC-CATCCTC Chimpanzee......T.ATT.....ACTGAAA....G.... Neander.#1GG.CTTTTATTC.T.CCCTGTAAGTATGCT.CT Neander.#2.C.....ATT.ATCCCCTGTAA.TATGCTTC Neander.#3GG......ATTC.TCCCCTGTAAGTATGCT.C Neander.#4GG......ATTC.TCCCCTGTAA.TATGCT.C

58 58 Neandertals – Limited Genetic Diversity Population # Individuals mtDNA differences MeanMin.Max. Neandertals Humans5, Chimpanzees Gorillas

59 59 Ancient Modern Human mtDNA mtDNA Sample (HVR-1) Age (ka) Sequence Number (Read Down) Modern Human 0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA Aboriginal CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C... Chimp0....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C.. Neander #1 30+ GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C... Ancient Aussie T.G CT.T....T..T......TC....G

60 60 Neandertal mtDNA Summary Neandertals have no genetic (nor evolutionary) connection to humans Neandertals displayed limited genetic diversity

61 61 Origin of Man Classic Hypothesis Neandertals H. antecessor H. ergaster European Humans African Humans Asian Humans

62 62 Origin of Man Multi-regional Hypothesis H. ergaster Asian Humans ? African Humans ? H. erectus H. antecessor Neandertals ? European Humans ?

63 63 Multiregional Hypothesis Requires Large breeding populations over the entire planet Frequent interbreeding of those populations Genetic roots traceable to millions of years bp

64 64 Genetic Data Contradicts Multiregional Hypothesis Study 1 African and Asian and oceanic peoples originated from same population group kya Study 2 90% of founding population must come from Africa and this population must be small

65 65 Genetic Data Contradicts Multiregional Hypothesis Study 3 (small population size) Nuclear DNA sequences Alu insertions HLA exons mtDNA mismatch distributions frequency spectra (mtDNA, Y-chr) allele size vs. homozygosity at tandem repeat loci

66 66 Homo erectus Development Homo erectus developed in a fashion similar to great apes – not modern humans Homo erectus developed from infanthood to adulthood rapidly

67 67 Descent of Modern Humans Most of the familiar specimens of Homo erectus and of archaic humans known from the Pleistocene were not members of populations ancestral to us Harpending, H.C., et al Genetic traces of ancient demography. Proc. Natl. Acad. Sci. USA 95:

68 68 Origin of Man Multi-regional Hypothesis H. ergaster Asian Humans ? African Humans ? H. erectus H. antecessor ? ? Neandertals European Humans

69 69 Scientific Data Anatomical – overall structure and body plan Physiological – how the body systems work and interact Biochemical – basic chemical pathways Similarities with other animals

70 70 Scientific Data Human – Chimpanzee genetics ~95-99% Genetic Similarity Base substitutions – 1.4% Insertions/Deletions – 3.4% Common Descent (?)

71 71 Humans and Chimpanzees Chromosome number Human (46) Chimp (48) Chromosome sizes Chromosomal banding #2 equivalent to two smaller chimp chromosomes #4 and #17 different

72 72 Chromosome 21 Human-Chimp Comparison Chromosome 21 fully sequenced and annotated Two clusters with significant differences PCR Result Chimp - Chimp and other primates - HS21 Clone Gaps

73 73 How Different From Chimpanzees? Human problem – anthropomorphizing The counting dog What do chimpanzees really understand?

74 74 Human Distinctives Large brain size Bipedalism Advanced culture Decreased size of back teeth

75 75 Emergence of Bipedalism Driven by habitat change from wood-land to open savanna?

76 76 Bipedalism Theories TheoryProblems Ecology (Woodland to Savanna) Occurred later 1 Hunting and toolsOccurred later 1 Thermoregulation 2 Occurred later 1 Enhanced visionWrong environment Male provider 3 hominids were reproductively disadvantaged 4 Scarce dietary resources Not fully supported by the data

77 77 Advantages of Bipedalism Travel for food Transport food Feed in stationary position Avoid predatory attacks Thermoregulatory advantages Tool use

78 78 Anatomy of Bipedalism Shorter/broader pelvis Human Great Ape Valgus angle The angle the femur (leg bone) makes relative to the knee. About 90 degrees in apes, less in bipeds Valgus angle The angle the femur (leg bone) makes relative to the knee. About 90 degrees in apes, less in bipeds Valgus angle Knee Lengthened lower limbs Enlarged joint surfaces

79 79 Anatomy of Bipedalism Restructuring of ear bones Platform foot Human Great Ape Foot arches Relocation of hallux (big toe)

80 80 Anatomy of Bipedalism Relocation of foramen magnum Human Great Ape Lower/upper spine curvature Restructuring of rib cage Rearrangement of musculature

81 81 Ecology of Bipedalism Early australopithecines lived in mixed woodland and savanna A. ramidus (5.8 and 4.5 mya) A. anamensis (4.2 mya) A. afarensis (3.9 mya) A. bahrelghazari (3.5 mya)

82 82 Natural History of Bipedalism Facultative bipeds A. ramidus (5.8 mya) A. anamensis (4.2 mya) A. habilis (2.5 mya)

83 83 Natural History of Bipedalism Obligatory bipeds (type I) H. erectus (2 million years ago) H. neandertalensis (150,000 years ago)

84 84 Natural History of Bipedalism Obligatory bipeds (type II) Homo sapiens sapiens (modern humans) (50,000 years ago)

85 85 Bipedalism in Hominins Time (MYA) Small brain, small teeth, quadruped Chimpanzee (Pan) Large brain, small teeth, obligate biped Man (Homo sapiens) H. neandertalensis H. heidelbergensis H. erectus H. ergaster Small brain, very large teeth, facultative biped P. boisei P. robusts Insufficient evidence H. antecessor H. rudolfemsis A. garbi K. platyops P. aethiopicus O. tugenesis S. tchadensis A. bahreighazali A. ramidus Small brain, large teeth, facultative biped A. habilis A. afarensis A. africanus A. anamensis Hominins Superfamily including the hominids (Genus Homo and Australopithecus) along with the bipedal apes and chimpanzees. Hominins Superfamily including the hominids (Genus Homo and Australopithecus) along with the bipedal apes and chimpanzees.

86 86 Emergence of Bipedalism Minimal driving force/selective pressure Appears suddenly in the fossil record Requires major anatomical rearrangement Rapid change followed by period of no change

87 87 Origin of Man Creation Model All Humans ADAM & EVE All other bipedal primate species are a special creation of God

88 88 Origin of the Human Races Biblical and Scientific Explanations

89 89 Origin of the Races Gods original command: And God blessed them; and God said to them, "Be fruitful and multiply, and fill the earth..." (Genesis 1:28)

90 90 Origin of the Races God reissued his command: "and as for you, be fruitful and multiply; Populate the earth abundantly and multiply in it." (Genesis 9:7)

91 91 World Peace and Unity? Human pride and greed result in oppression of people Media-Persia Greece Rome

92 92 Gods Peace and Unity Do you suppose that I came to grant peace on earth? I tell you, no, but rather division; (Luke 12:51) Peace I leave with you; My peace I give you. I do not give to you as the world gives. (John 14:27)

93 93 Early Post-Flood Civilization Rapid repopulation of Mesopotamia Nimrod built 8 large cities, including Nineveh Biblical data

94 94 Scattering of the Worlds People At the city of Babel, the people began building a huge tower God confused their language and scattered them over the face of the earth Biblical data

95 95 Scattering of the Worlds People Geographic barriers Bering Strait – Americas and Asia Strait of Malaca – Indonesia and Asia Torres Strait – Australia and Asia Land bridges established by the ice age

96 96 Dividing the Earth Biblical data Two sons were born to Eber: One was named Peleg, because in his time the earth was divided… (Genesis 10:25) Scientific Data Land bridges covered by rising oceans ~11,000 ya

97 97 Origin of the Races What the Bible says Moses married a Cushite woman) (Numbers 12:1) Solomon married a black woman (Song of Songs 1:5) Ethiopians described as dark- skinned (Jeremiah 13:23)

98 98 Origin of the Races What the Bible doesnt say When and how did the races begin? No biblical data – Not important enough to mention? Mark of Cain? Hams penalty? Part of the scattering at the Tower of Babel?

99 99 Origin of the Races Race facts: Single biological species - Homo sapiens sapiens. Race described on the basis of skin color, hair form, facial morphology, body proportions, and other, less obvious traits – not based upon genetics

100 100 Origin of the Races Scientific classification African (groups indigenous to Africa) Caucasian (European populations) Greater Asian (Mongols, Polynesians, Micronesians) Amerindian (North & South American Indians, Eskimos) Australoid (Australia, Papua)

101 101 Biological Basis for Race No specific race genes Skin color – melanin (phenomelanin and eumelanin) Melanin expression – controlled by the enzyme tyrosinase All people have enough tyrosinase to be very black in skin color Regulation of the tyrosinase determines skin color

102 102 Origin of the Races Protein polymorphisms 84% of all variation is found within each racial group 10% of variation is found among racial groups More genetic variation within races than between them

103 103 Skin Color Distribution Vs. Blood Type Type A Type B Relative Skin Color equator

104 104 Racial Diversity Among Chimpanzees Compared to Humans MeasureChimpsHumans X-chromosome0.13%0.037% mtDNA (MPSD) Fst values> Substitution rate> Heterozygosity3.9%1.8%

105 105 Scientific Theories on the Origin of Human Races Dark skin protects against ultraviolet radiation and cancer Light skin allows enhanced formation of vitamin D3 Exception – Inuit (Eskimos) Selective breeding

106 106 Origin of Races – Conclusions The origin of the races was not thought to be important enough to put in the Bible Biological changes required to produce human races are well within those possible through microevolutionary processes

107 107 Modern Humans – Comparison of Models AppearanceCreationDarwinism FossilsSuddenlyGradual CultureRapidGradual LocationSingle siteMany sites? DescentNone Unknown ancestor

108 108 Summary Modern humans originated recently from a small population at a single geographic location Modern culture and religious expression appeared suddenly and dramatically Modern humans are not descended from Neandertal, H. erectus or any other identifiable bipedal hominid

109 109 Conclusions Naturalistic explanations fail to explain the origin of modern man Supernatural creation is a superior model for understanding mans origin The races of man likely originated from selective breeding and not a supernatural act, although they may have been the indirect result of the scattering at the tower of Babel


Download ppt "1 Origin of Man and the Races Richard Deem, M.S. Reasons To Believe."

Similar presentations


Ads by Google