Presentation is loading. Please wait.

Presentation is loading. Please wait.

Fig. 20-11 TECHNIQUE Nitrocellulose membrane (blot) Alkaline solution DNA transfer (blotting) Sponge Gel Heavy weight Paper towels Preparation of restriction.

Similar presentations


Presentation on theme: "Fig. 20-11 TECHNIQUE Nitrocellulose membrane (blot) Alkaline solution DNA transfer (blotting) Sponge Gel Heavy weight Paper towels Preparation of restriction."— Presentation transcript:

1 Fig TECHNIQUE Nitrocellulose membrane (blot) Alkaline solution DNA transfer (blotting) Sponge Gel Heavy weight Paper towels Preparation of restriction fragments Gel electrophoresis I II III Radioactively labeled probe for CD4 gene RNA macrophageB cellsT cells Film over blot Probe detection Hybridization with radioactive probe Probe base-pairs with mRNA Nitrocellulose blot Northern Blot (to detect CD4 mRNA)

2 Fig TECHNIQUE RESULTS Gel electrophoresis cDNAs CD4 mRNA PCR amplification Different cell types Primers mRNAs cDNA synthesis Reverse Transcriptase PCR (RT-PCR) to detect CD4 mRNA

3 Fig TECHNIQUE Isolate mRNA. Make cDNA by reverse transcription, using fluorescently labeled nucleotides. Apply the cDNA mixture to a microarray, a different gene in each spot. The cDNA hybridizes with any complementary DNA on the microarray. Rinse off excess cDNA; scan microarray for fluorescence. Each fluorescent spot represents a gene expressed in the tissue sample. Tissue sample mRNA molecules Labeled cDNA molecules (single strands) DNA fragments representing specific genes DNA microarray with 2,400 human genes DNA microarray Microarrays to detect many (or all) mRNAs at once

4 WT dif1 myb98 genes Example of array data

5 Table 21-1

6 Human Genome Project (Multinational Consortium) Entire 3 x 10^9 nucleotide sequence of a composite haploid human genome ~$500 million - $1 billion Celera Genomics (Private Company) Shotgun sequencing approach ~ $300 million Divide and conquer approach

7

8

9 Fig a DNA (template strand) TECHNIQUE DNA polymerase Primer DeoxyribonucleotidesDideoxyribonucleotides (fluorescently tagged) dATP dCTP dTTP dGTP ddATP ddCTP ddTTP ddGTP How can we sequence DNA? (Sanger dideoxy method)

10 Fig b TECHNIQUE RESULTS DNA (template strand) Shortest Labeled strands Longest Shortest labeled strand Longest labeled strand Laser Direction of movement of strands Detector Last base of longest labeled strand Last base of shortest labeled strand

11 Linkage mapping Genetic markers Physical mapping Overlapping fragments DNA sequencing How can we sequence an entire genome?

12 Linkage mapping Genetic markers Physical mapping Overlapping fragments DNA sequencing How can we sequence an entire genome? Genome sequencing: Divide and conquer approach -Ordered, large fragments of chromosomes are cloned

13 Fig Bacterial cell Bacterial plasmid lacZ gene Hummingbird cell Gene of interest Hummingbird DNA fragments Restriction site Sticky ends amp R gene TECHNIQUE Recombinant plasmids Nonrecombinant plasmid Bacteria carrying plasmids RESULTS Colony carrying non- recombinant plasmid with intact lacZ gene One of many bacterial clones Colony carrying recombinant plasmid with disrupted lacZ gene

14 Linkage mapping Genetic markers Physical mapping Overlapping fragments DNA sequencing Genome sequencing: Divide and conquer approach - Ordered, large fragments of chromosomes are cloned -Each fragment is sequenced How can we sequence an entire genome?

15 Cut the DNA into overlapping fragments short enough for sequencing Clone the fragments in plasmid or phage vectors. Sequence each fragment. Order the sequences into one overall sequence with computer software. Shotgun sequencing approach

16 TTATTTCCCATTTTTCTTAAAAAGGAAGAACAAACTGTGCCCTAGGGTTTACTGTGTCAGAACAGAGTGTGCCGATTGTGG TCAGGACTCCATAGCATTTCACCATTGAGTTATTTCCGCCCCCTTACGTGTCTCTCTTCAGCGGTCTATTATCTCCAAGAG GGCATAAAACACTGAGTAAACAGCTCTTTTATATGTGTTTCCTGGATGAGCCTTCTTTTAATTAATTTTGTTAAGGGATTTCC TCTAGGGCCACTGCACGTCATGGGGAGTCACCCCCAGACACTCCCAATTGGCCCCTTGTCACCCAGGGGCACATTTCAG CTATTTGTAAAACCTGAAATCACTAGAAAGGAATGTCTAGTGACTTGTGGGGGCCAAGGCCCTTGTTATGGGGATGAAGG CTCTTAGGTGGTAGCCCTCCAAGAGAATAGATGGTGAATGTCTCTTTTCAGACATTAAAGGTGTCAGACTCTCAGTTAATC TCTCCTAGATCCAGGAAAGGCCTAGAAAAGGAAGGCCTGACTGCATTAATGGAGATTCTCTCCATGTGCAAAATTTCCTCC ACAAAAGAAATCCTTGCAGGGCCATTTTAATGTGTTGGCCCTGTGACAGCCATTTCAAAATATGTCAAAAAATATATTTTGG AGTAAAATACTTTCATTTTCCTTCAGAGTCTGCTGTCGTATGATGCCATACCAGAGTCAGGTTGGAAAGTAAGCCACATTAT ACAGCGTTAACCTAAAAAAACAAAAAACTGTCTAACAAGATTTTATGGTTTATAGAGCATGATTCCCCGGACACATTAGATA GAAATCTGGGCAAGAGAAGAAAAAAAGGTCAGAGTTTAATCCTCATTCCTAAGTTATGTAAACCAAAAATAAAATTCTGAAG ATGTCCTGATCATCTGAATGGACCCTTCCTCTGGACCAGGGCATTCCAAAGTTAACCTGAAAATTGGTTTGGGCCATGAT GGGAAGGGAGGTTTGGATATGCCTCATTATGCCCTCTTCCCTTTCAGAATTCAGGAAAAGCCAACCAGCATTAACATCAAC ACAGATTTTCAGATCTTAGGTTTCTTTCCGATCTATTCTCTCTGAACCCTGCTACCTGGAGGCTTCATCTGCATAATAAAAC TTTAGTCTCCACAACCCCTTATCTTACCCCAGACATTCCTTTCTATTGATAATAACTCTTTCAACCAATTGCCAATCAGGGTA TGTTTAAATCTACCTATGACCTGGAAGCCCCCACTTTGCACCCTGAGATCAAACCAGTGCAAATCTTATATGTATTGATTTG TCAATGAAAACAGTCAAAGCCAGTCAGGCACAGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCTGAGGCGGGTA GATCACCTGAGGTCAGGAGTTCGACACCAGCCTGGCCAACATGGTGAAACCCCGTCCCTACTAAAATACAAAAATTAGCC CAGCTTGGTGGTGGGCACCTGTAATCTTAGCTACTGCAGAGACTGAGGCAGGAGAATCGCTTGAACCCAGGAGGTGGA GGTTGCAGTGACCTGAGATTTTGCCATTGCACTCCAGCCTGGGCAACAGAGCAAGACTCTATCTCAAAAAACAAACAAAC AAACAAACAAACAAACAAACTGTCAAAATCTGTACAGTATGTGAAGAGATTTGTTCTGAACCAAATATGAATGACCATGGTC CATGACACAGCCCTCAGAAGACCCTGAGAACATGTGCCCAAGGTGGTCACAGTGCATCTTAGTTTTGTACATTTTAGGGA GATATGAGACTTCAGTCAAATACATTTTTAAAAAATACATTGGTTTTGTCCAGAAAGCCAGAACCACTCAAAGCAGGGGTTT CCAGGTTATAAGTAGATTTAAAATTTTTCTGATTGACAATTGGTTGAAAGAGTTGTCAATAGAAAGGAATGTCTGCATTGTG ACAAGAGGTTGTGGAGACCAAGTTTCTGTCATGCAGATGAAGCCTTCAGGTAGCAGGCTTCCAAGATAACAGGTTGTAAA TAGTTCTTATCAGACTTAAGTTCTGTGGAGACGTAAAATGAGGCATATCTGACCTCCACTTCCAAAAACATCTGAGACAGG TCTCAGTTAATTAAGAAAGTTTGTTCTGCCTAGTTTAAGGACATGCCCATGACACTGCCTCAGGAGGTCCTGACAGCATGT GCCCAAGGTGGTCAGGATACAGCTTGCTTCTATATATTTTAGGGAGAAAATACATCAGCCTGTAAACAAAAAATTAAATTCT AAGGTCCCTGAACCATCTGAATGGGCTTTCTTCTAGGCCAGGGCACTCTAAAATTGAAGAACCTGAACATTCCTTTCTATT GATAATACTTTCAGCCAGTTGAGCCCATTCAGACCACAGCAAGGTGCCAGGCCAGGCAAGGGCTGACTTGAGATACCTG CCAGATGAGTCACTGGCAAAAGGTGCTGCTCCCTGGTGAGGGAGAAACACCAGGGGCTGGGAGAGGCCCAGAAGGCT CTGAAGGAGTTTTGGTTTGGCTGGCCATGTGTGCAATTAGCGTGATGAGCTCTGACATGGCCTTGCATGGACGGATTGG GCAGGACACCCCAGCTGAGGAGGATGGCAGGAGTGATGGCACAGGGGAAAGGGTGGCATACCCAGGTGACAGCTCCC CACTACCTCCACTCTGTGCTGCAGCTCAGGGGCTGGGTCTTCTGCTGCAACTCAGCCCCTCTGTACCAGCCCTGGCCTC ATTCCCTTGGTTCCAGGACACCCAGCTGACAAAAGGGACTTGCCTGTACCCCTGCACCTGGTCCTACACCTGGCTCCTG GGTTGTCAGCAGGTGTTTGTTGGGCCAACGAGTGCATGGATGGAAACACAGACAGAAGGACAGATGGAGAGATGGTGG GTGGCCAGACAAAGGAGTAACTTGGTGAGGAATGTGCATTAGGAAATCACAGAAGAGCAGAAACTGTTTGAAAATTCCAA GTGGGGAAAGTGAGGAGGTGAAGCAGGGCTGAAGGGCCTCCCTCAGAGCCTTCTCCCACTCTGTGGTGTCCACATCCC CTTGGTCGTCCTTGTGGGAGGCACTCACCTTTTGCTCAGCCTATTGTGGCTACAGCCCAGCAGGTCCCAGGTGGCACCA GCCAAGATGAAGGTGGCATTGAGGGCTGAAGTCTCCCTCACCATGAAGGGATGATGTATAGTGGGTGGGGCCTCAGGA GGAAGAG GGCCACCAACCCTACCTGGCCCCTAACCTGCTGCCTGGAGTAGGCAGGTACCAGAGGCATGGGGTGAGGCATGTTGCA GGTCGAGGACCAGGGCCATCTCACTGCCTGAGCCCATGGACTGGCTCAGGGGTCTGTCAGATGATTCTAGAGCTGAGT TGGAGGTAAGGGCAGGGGGTTTGTTCCTGGGTTCAAGACCATGGAAGGAAGGGGTAGAGAAGGAGGCCAACAAGTGA GGAGGCAAATTACAGTGGCTGGCAGAAGGAGAGAGAAGCCAGGACAGGTGGCTGTGGCCCTGTCCCTGCAGGCAGAC CCAGGAAGGAGCTCAGAGACAGGATTCATGCCAAGCCTGCCTACCCAGCACATCTCTCCTCATGGACATGAGAGAAAAC CCTCCAGCTTGGCCCTCACATCTGTGAAACCCACAGTAATGGGGCTGACATCCTCTGCCCTATGCAAGAGAGGTTTCCC AAGCACTTGCAGCAAGTGAGACTGCACAGGATGGCGAATCCACAAAGAACACGTTGTTCTCATGCTCTTTGGAAGCACC AATTTACATTCTG The Human Genome (partial sequence….)

17 Table 21-1

18 Fig Exons (regions of genes coding for protein or giving rise to rRNA or tRNA) (1.5%) Repetitive DNA that includes transposable elements and related sequences (44%) Introns and regulatory sequences (24%) Unique noncoding DNA (15%) Repetitive DNA unrelated to transposable elements (15%) L1 sequences (17%) Alu elements (10%) Simple sequence DNA (3%) Large-segment duplications (5–6%)

19 Comparison of gene organization in different species (centered on region containing RNA polymerase gene)

20 Fig. 21-9a Transposon New copy of transposon DNA of genome Transposon is copied Insertion Mobile transposon (a) Transposon movement (copy-and-paste mechanism)

21 Fig. 21-9b Retrotransposon New copy of retrotransposon Reverse transcriptase Insertion RNA (b) Retrotransposon movement

22 TECHNIQUE Gel electrophoresis cDNAs PCR amplification Primers mRNAs cDNA synthesis Reverse Transcriptase PCR (RT-PCR) Large scale sequencing of cDNA fragments Sequence large numbers (millions) of cDNA fragments

23 No UV (3 samples) UV (3 samples) Large scale sequencing of cDNA fragments Fragments matching rad51


Download ppt "Fig. 20-11 TECHNIQUE Nitrocellulose membrane (blot) Alkaline solution DNA transfer (blotting) Sponge Gel Heavy weight Paper towels Preparation of restriction."

Similar presentations


Ads by Google