Presentation is loading. Please wait.

Presentation is loading. Please wait.

MOLECULAR BIOLOGY – Molecular biology techniques MOLECULAR BIOLOGY TECHNIQUES I. DNA isolation and fragmentation Recombinant DNA Gel electrophoresis Hybridization.

Similar presentations


Presentation on theme: "MOLECULAR BIOLOGY – Molecular biology techniques MOLECULAR BIOLOGY TECHNIQUES I. DNA isolation and fragmentation Recombinant DNA Gel electrophoresis Hybridization."— Presentation transcript:

1 MOLECULAR BIOLOGY – Molecular biology techniques MOLECULAR BIOLOGY TECHNIQUES I. DNA isolation and fragmentation Recombinant DNA Gel electrophoresis Hybridization Southern blot, RFLP

2 MOLECULAR BIOLOGY – Molecular biology techniques Mendel Morgan Watson & Crick Avery, MacLeod & McCarty

3 human DNA: letters Approx 25,000 genes filling 150x MOLECULAR BIOLOGY – Molecular biology techniques Human genome sequence NOT BAD WORK INSIDE 150 YEARS !!!! 1977 Sanger 2004

4 START STOP A U G G C A A U C A A G U G C U A A RNA T A C C G T T A G T T C A C G A T T A T G G C A A T C A A G T G C T A A GTTTATTGCATTCTTCTGTGAAAAGAAGCTGTTCACAGAATGATTCTGAAGAACCAACTT TGTCCTTAACTAGCTCTTTTGGGACAATTCTGAGGAAATGTTCTAGAAATGAAACATGTT CTAATAATACAGTAATCTCTCAGGATCTTGATTATAAAGAAGCAAAATGTAATAAGGAAA AACTACAGTTATTTATTACCCCAGAAGCTGATTCTCTGTCATGCCTGCAGGAAGGACAGT GTGAAAATGATCCAAAAAGCAAAAAAGTTTCAGATATAAAAGAAGAGGTCTTGGCTGCAG CATGTCACCCAGTACAACATTCAAAAGTGGAATACAGTGATACTGACTTTCAATCCCAGA AAAGTCTTTTATATGATCATGAAAATGCCAGCACTCTTATTTTAACTCCTACTTCCAAGG ATGTTCTGTCAAACCTAGTCATGATTTCTAGAGGCAAAGAATCATACAAAATGTCAGACA AGCTCAAAGGTAACAATTATGAATCTGATGTTGAATTAACCAAAAATATTCCCATGGAAA AGAATCAAGATGTATGTGCTTTAAATGAAAATTATAAAAACGTTGAGCTGTTGCCACCTG AAAAATACATGAGAGTAGCATCACCTTCAAGAAAGGTACAATTCAACCAAAACACAAATC TAAGAGTAATCCAAAAAAATCAAGAAGAAACTACTTCAATTTCAAAAATAACTGTCAATC CAGACTCTGAAGAACTTTTCTCAGACAATGAGAATAATTTTGTCTTCCAAGTAGCTAATG AAAGGAATAATCTTGCTTTAGGAAATACTAAGGAACTTCATGAAACAGACTTGACTTGTG TAAACGAACCCATTTTCAAGAACTCTACCATGGTTTTATATGGAGACACAGGTGATAAAC AAGCAACCCAAGTGTCAATTAAAAAAGATTTGGTTTATGTTCTTGCAGAGGAGAACAAAA ATAGTGTAAAGCAGCATATAAAAATGACTCTAGGTCAAGATTTAAAATCGGACATCTCCT TGAATATAGATAAAATACCAGAAAAAAATAATGATTACATGAACAAATGGGCAGGACTCT TAGGTCCAATTTCAAATCACAGTTTTGGAGGTAGCTTCAGAACAGCTTCAAATAAGGAAA TCAAGCTCTCTGAACATAACATTAAGAAGAGCAAAATGTTCTTCAAAGATATTGAAGAAC AATATCCTACTAGTTTAGCTTGTGTTGAAATTGTAAATACCTTGGCATTAGATAATCAAA AGAAACTGAGCAAGCCTCAGTCAATTAATACTGTATCTGCACATTTACAGAGTAGTGTAG TTGTTTCTGATTGTAAAAATAGTCATATAACCCCTCAGATGTTATTTTCCAAGCAGGATT TTAATTCAAACCATAATTTAACACCTAGCCAAAAGGCAGAAATTACAGAACTTTCTACTA TATTAGAAGAATCAGGAAGTCAGTTTGAATTTACTCAGTTTAGAAAACCAAGCTACATAT TGCAGAAGAGTACATTTGAAGTGCCTGAAAACCAGATGACTATCTTAAAGACCACTTCTG AGGAATGCAGAGATGCTGATCTTCATGTCATAATGAATGCCCCATCGATTGGTCAGGTAG ACAGCAGCAAGCAATTTGAAGGTACAGTTGAAATTAAACGGAAGTTTGCTGGCCTGTTGA AAAATGACTGTAACAAAAGTGCTTCTGGTTATTTAACAGATGAAAATGAAGTGGGGTTTA GGGGCTTTTATTCTGCTCATGGCACAAAACTGAATGTTTCTACTGAAGCTCTGCAAAAAG CTGTGAAACTGTTTAGTGATATTGAGAATATTAGTGAGGAAACTTCTGCAGAGGTACATC CAATAAGTTTATCTTCAAGTAAATGTCATGATTCTGTTGTTTCAATGTTTAAGATAGAAA ATCATAATGATAAAACTGTAAGTGAAAAAAATAATAAATGCCAACTGATATTACAAAATA ATATTGAAATGACTACTGGCACTTTTGTTGAAGAAATTACTGAAAATTACAAGAGAAATA CTGAAAATGAAGATAACAAATATACTGCTGCCAGTAGAAATTCTCATAACTTAGAATTTG ATGGCAGTGATTCAAGTAAAAATGATACTGTTTGTATTCATAAAGATGAAACGGACTTGC TATTTACTGATCAGCACAACATATGTCTTAAATTATCTGGCCAGTTTATGAAGGAGGGAA ACACTCAGATTAAAGAAGATTTGTCAGATTTAACTTTTTTGGAAGTTGCGAAAGCTCAAG How to study this amazing amount of information? MOLECULAR BIOLOGY – Molecular biology techniques

5 1 ISOLATION OF DNA

6 High MW Genomic DNA Isolation Typical Procedure 1Cell Lysis –0.5% SDS + proteinase K (55 o C several hours) 2Phenol Extraction –gentle rocking several hours Phenol Extraction mix sample with equal volume of sat. phenol soln retain aqueous phase optional chloroform/isoamyl alcohol extraction(s) aqueous phase (nucleic acids) phenolic phase (proteins) MOLECULAR BIOLOGY – Molecular biology techniques ORGANIC PHASE SEPARATION

7 High MW Genomic DNA Isolation Typical Procedure 1Cell Lysis –0.5% SDS + proteinase K (55 o C several hours) 2Phenol Extraction –gentle rocking several hours 3Ethanol/ salt Precipitation EtOH Precipitation volumes EtOH, -20 o C high salt, pH centrifuge or spool out MOLECULAR BIOLOGY – Molecular biology techniques 4 RNAse followed by proteinase K 5 Repeat Phenol Extraction and EtOH ppt

8 PLASMID DNA MOLECULAR BIOLOGY – Molecular biology techniques Natural Bacterial Transformation/ conjugation Also possible to experimentallytransform plasmid vectors into bacteria - see later S. Pneumoniae transforming DNA is a plasmid

9 PLASMID DNA ISOLATION Alkaline lysis denaturation/ renaturation protocol MOLECULAR BIOLOGY – Molecular biology techniques Protein denaturation (SDS) Single stranded plasmid DNA Single stranded genomic DNA Bacteria lysed in SDS + strong NaOH buffer DENATURATION Small multi-copy plasmid DNA quickly re-anneals in solution Large single copy genomic DNA fails to re-anneal and forms precipitate with proteins Potassium acetate pH NEUTRALISATION SEDIMENTATION Centrifugation Aqueous (double stranded plasmid DNA) Pellet (proteins and genomic DNA)

10 MOLECULAR BIOLOGY – Molecular biology techniques PLASMID DNA ISOLATION Aqueous (double stranded plasmid DNA) Pellet (proteins and genomic DNA) 1. Phenol/ CHCl3 extraction & Ethanol/ Salt precipitation or 2. Solid phase/ silica extraction miniprep Quick relatively pure double stranded plasmid DNA In presence of alkaline chaotropic salts, denatured plasmid DNA binds to silica beads in the column Wash buffers used to remove impurities & DNA eluted (and re-natured in H 2 O) Centrifugation steps

11 MOLECULAR BIOLOGY – Molecular biology techniques PLASMID DNA ISOLATION Aqueous (double stranded plasmid DNA) Pellet (proteins and genomic DNA) or 3. Anion exchange column-based chromatography Altering the pH and ionic conditions removes impurities leading to high [salt] elution and EtOH or isopropanol precipitation Extremley pure double stranded plasmid DNA

12 Isolation of RNA Special Considerations RNAse inhibitors! extraction in guanidine salts phenol extractions at pH 5-6 (pH 8 for DNA) selective precipitation of high MW forms (rRNA, mRNA) with LiCl oligo-dT column for mRNAs treatment with RNase-free DNase MOLECULAR BIOLOGY – Molecular biology techniques Guanidinium thiocyanate

13 Using UV spectroscopy to analyze DNA/ RNA Nucleic acids absorbs UV light with a major peak at 260nm ( max) Absorbance Wave Length ( ) 260 MOLECULAR BIOLOGY – Molecular biology techniques Detection Quantitation Assessment of purity Absorbance extinction coefficients ( ) vary depending on the nucleic acid structure A260 Isolated nucleotides ss RNA/ DNA = 25 ds DNA = 20 A 260 / A 280 ratio indicates sample purity Pure RNA = 2.0 Pure DNA = 1.8 Beer-Lambert equation A = cl

14 So now we have isolated DNA...but it is still too long to work with: 2 how to fragment it? - mechanical shearing (no control) or... MOLECULAR BIOLOGY – Molecular biology techniques

15 MOLECULAR SCISSORS - TYPE II RESTRICTION ENDONUCLEASES Hamilton Othanel Smith 1968 cohesive ends MOLECULAR BIOLOGY – Molecular biology techniques SPECIFIC CUT SPECIFIC JOINING (LIGATION) Ability to join two foreign pieces of DNA together

16 MOLECULAR BIOLOGY – Molecular biology techniques BLUNT END COHESIVE ENDS

17 RECOMBINANT DNA TECHNOLGY MOLECULAR BIOLOGY – Molecular biology techniques The plasmid as DNA vector (vehicle) Possible to insert interesting DNAs into a plasmid using restriction endonucleases 3

18 RECOMBINANT DNA TECHNOLGY MOLECULAR BIOLOGY – Molecular biology techniques The plasmid as DNA vector (vehicle) The recombinant plasmid containing theinteresting DNA sequence can now be propagated/ amplified by experimentally transforming the recombinant plasmid into bacteria and allowing these bacteria to multiply and produce more recombinant plasmid Specialized strains of bacteria can be permeablised by electroporation of heat shock Therefore specific DNA fragments can be selectively propagated i.e. cloned

19 RECOMBINANT DNA TECHNOLGY MOLECULAR BIOLOGY – Molecular biology techniques Specialized plasmid cloning vectors Muliple Cloning Site (MCS) contains many restriction sites to maximize target DNA cloning potential Plasmids contain genes that confer antibiotic resistance so that only successfully transformed bacteria are propagated

20 3 Why not clone whole genomes? MOLECULAR BIOLOGY – Molecular biology techniques Each bacterial colony represents an amplified clone containing a recombinant plasmid harbouring a distinct region of the genome i.e. together they represent a Genomic DNA Library Also possible to do this using cDNA copies of transcribed mRNAs resulting a cDNA Gene Expression Library

21 MOLECULAR BIOLOGY – Molecular biology techniques Bacteriophage Lambda vectors phage linear DNA genome Non-essential region allowing that can be substituted by DNA to be cloned (approx 20Kb) cos Cosmids, phosmids, BACs and YACs to clone larger DNA fragments

22 DNA ISOLATION AMPLIFICATION How to visualize DNA? GEL ELECTROPHORESISNUCLEIC ACID HYBRIDIZATION size distinction sequence distinction MOLECULAR BIOLOGY – Molecular biology techniques 4

23 GEL ELECTROPHORESIS fragmented DNA MOLECULAR BIOLOGY – Molecular biology techniques D-galactose 3,6-anhydro L-galactose n agarose

24 Ethidium Bromide SYBR® Safe on blue light MOLECULAR BIOLOGY – Molecular biology techniques

25 23 kb 9,5 kb Genomic DNA on gel: MOLECULAR BIOLOGY – Molecular biology techniques

26 Plasmid DNA on gel: MOLECULAR BIOLOGY – Molecular biology techniques

27 NUCLEIC ACID HYBRIDIZATION Fluorescence In Situ Hybridization (FISH) labeled probe MOLECULAR BIOLOGY – Molecular biology techniques Metaphase spread chromosomes on a slide

28 Biotin-11-dUTP 32 P radioactive labeling Probe labeling by incorporation of modified (d)NTPs AUTORADIOGRAPHY Streptavidin Y anti-DIG antibody (DIG) Fluorophores conjugation Enzymes alkaline phosphatase horseradish peroxidase chemiluminiscence MOLECULAR BIOLOGY – Molecular biology techniques

29 DIG Y HRP substrate light Y HRP substrate light Y HRP substrate light Y HRP substrate light Y HRP substrate light Y HRP substrate light MOLECULAR BIOLOGY – Molecular biology techniques

30 DNA denaturation Melting (denaturation) temperature depends on these major factors: - GC content (and therefore AT content) - sequence length - gaps in the annealed strands - salt concentration - pH - organic solvents (DMSO, formamide...) GC rich AT rich Temp MOLECULAR BIOLOGY – Molecular biology techniques

31

32 CHROMOSOME PAINTING – MULTI COLOR FISH MOLECULAR BIOLOGY – Molecular biology techniques Particularly useful when diagnosing chromsomal abnormalities in certain forms of cancer (region specific barcoding on left and whole chromsosome paints on right) Translocated chromsome segment

33 Where in organism is the gene expressed? Detection of mRNA by in situ hybridization: MOLECULAR BIOLOGY – Molecular biology techniques Adaptation of DNA FISH protocol (removal of genomic DNA by predigestion with DNase and use of labeled RNA probes to detect expressed transcripts)

34 MOLECULAR BIOLOGY – Molecular biology techniques How to analyze specific form of genes in genomic DNA? e.g. successful intergration of a transgene into the genome of a transgeneic animal (mouse)

35 Figure 8-38 (part 1 of 4) Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – Molecular biology techniques Southern blot – transfer of DNA to membrane fragmented DNA e.g. fragmentation by restriction endonucleases

36 Figure 8-38 (part 2 of 4) Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – Molecular biology techniques

37 Figure 8-38 (part 3 of 4) Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – Molecular biology techniques Labeled probe has sequence homology to DNA of interest e.g. the hopefully integrated transgene

38 Figure 8-38 (part 4 of 4) Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – Molecular biology techniques e.g. bands reveal integrated transgenes and size shows whether integration was correct

39 Figure 8-38 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – Molecular biology techniques SOUTHERN BLOT combines DNA fragmentation, gel electrophoresis and hybridization to analyze specific DNA sequences Same procedure blotting RNA used to confirm gene mRNA expression called NORTHERN BLOTTING Similar principle used to blot proteins that are then detected by specific antibodies - WESTERN BLOTTING

40 SINGLE NUCLEOTIDE POLYMORPHISM (SNP) MOLECULAR BIOLOGY – Molecular biology techniques

41 R estriction F ragment L ength P olymorphism (RFLP) 3AGCTAGCGTGCTGTGATGTAGCTGATGCTGAATTCTGCGATGTT5 5TCGATCGCACGACACTACATCGACTACGACTTAAGACGCTACAA3 3AGCTAGCGTGCTGTGATGTAGCTGATGCTGAATGCTGCGATGTT5 5TCGATCGCACGACACTACATCGACTACGACTTACGACGCTACAA3 SNP EcoRI 3AGCTAGCGTGCTGTGATGTAGCTGATGCTG AATTCTGCGATGTT5 5TCGATCGCACGACACTACATCGACTACGACTTAA GACGCTACAA3 3AGCTAGCGTGCTGTGATGTAGCTGATGCTGAATGCTGCGATGTT5 5TCGATCGCACGACACTACATCGACTACGACTTACGACGCTACAA3 Restriction digestion by EcoRI MOLECULAR BIOLOGY – Molecular biology techniques

42 RFLP MOLECULAR BIOLOGY – Molecular biology techniques

43 Diagnosis of Genetic Diseases by RFLP MOLECULAR BIOLOGY – Molecular biology techniques

44 Hybridization to filter complementary cloning GENOMIC or cDNA EXPRESSION LIBRARY MOLECULAR BIOLOGY – Molecular biology techniques isolate DNA

45 . genomic library hybridisation restriction digestion MOLECULAR BIOLOGY – Molecular biology techniques sub-clone experimentation

46 How to see genes where in tissues?... where on chromosomes? How to see specific forms of genes? How to clone and amplify genes? southern blot RFLP in situ hybridizationrecombinant DNA MOLECULAR BIOLOGY – Molecular biology techniques genomic libraries

47 Table 8-3 Molecular Biology of the Cell (© Garland Science 2008) MOLECULAR BIOLOGY – Molecular biology techniques


Download ppt "MOLECULAR BIOLOGY – Molecular biology techniques MOLECULAR BIOLOGY TECHNIQUES I. DNA isolation and fragmentation Recombinant DNA Gel electrophoresis Hybridization."

Similar presentations


Ads by Google