Presentation is loading. Please wait.

Presentation is loading. Please wait.

Happy New Year -Grab a big whiteboard and a markers for your table.

Similar presentations

Presentation on theme: "Happy New Year -Grab a big whiteboard and a markers for your table."— Presentation transcript:


2 Happy New Year -Grab a big whiteboard and a markers for your table

3 Today Review – DNA/RNA Structure – DNA Replication – Protein Synthesis Transcription mRNA processing Translation – Mutations

4 Schedule for the week Tuesday – Review Wednesday – Review for test and midterm Thursday – Test (50 questions), review for midterm Friday – Review for midterm Monday – Review for midterm Tuesday – Friday - Midterms

5 Whiteboard activity 1 st activity – Draw a DNA molecule (3 base pairs) Label: phosphate, deoxyribose sugar, what bases it has, how many H bonds in between bases, 5, 3, purines, pyrimidines, # the carbons of 1 sugar – Draw a RNA molecule (3 nucleotides) Label everything applicable



8 Whiteboard activity 2 nd activity – Draw a replication fork Label: helicase, SSBPs, toposisomerase, 5, 3, DNA poly III, leading strand, lagging strand, primase, primer, ligase, Okazaki fragments

9 DNA Replication

10 Raven - Johnson - Biology: 6th Ed. - All Rights Reserved - McGraw Hill Companies 3 options

11 Question? After 20 rounds of DNA replication (cell division), how many cells will have parent DNA in them?

12 Supercoiling Topoisomerases – prevent supercoiling from unraveling of DNA helix


14 Telomerase – elongates end of 5 end of DNA to prevent loss (end is called a telomere (TTAGGG repeat) Small strand of RNA

15 DNA Repair Mismatch repair: DNA polymerase Excision repair: Nuclease Telomere ends: telomerase (may play a part in cancer treatment)

16 Whiteboard activity 3 rd activity – Protein synthesis – Write this DNA sequence 3 – TACG-CGCA-GAACC-TATGC-CCAA-GAC-TTAAA – 5 -Write the complementary mRNA -Process the mRNA -Black segments – exonsRed – introns -Put on methylated 5 cap -Put on poly A tail -Write the mature mRNA transcript at the bottom of the whiteboard -Translate the mRNA by drawing the tRNAs bonded to the mRNA and writing the corresponding amino acid it brings

17 Whiteboard activity 4 th activity – Mutations

18 From Gene to Protein How Genes Work

19 What do genes code for? proteinscellsbodies How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA

20 Protein Structure

21 The Central Dogma Flow of genetic information in a cell – How do we move information from DNA to proteins? transcription translation replication protein RNA DNAtrait DNA gets all the glory, but proteins do all the work!



24 Inheritance of metabolic diseases – suggested that genes coded for enzymes – each disease (phenotype) is caused by non- functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? Metabolism taught us about genes ABCDE disease enzyme 1enzyme 2enzyme 3enzyme 4 metabolic pathway

25 Beadle & Tatum 1941 | 1958 George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events" one gene : one enzyme hypothesis

26 Wild-type Neurospora Minimal medium Select one of the spores Grow on complete medium Minimal control Nucleic acid Choline PyridoxineRiboflavin Arginine Minimal media supplemented only with… Thiamine Folic acid Niacin Inositol p-Amino benzoic acid Test on minimal medium to confirm presence of mutation Growth on complete medium X rays or ultraviolet light asexual spores Beadle & Tatum create mutations positive control negative control experimentals mutation identified amino acid supplements

27 mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa protein translation ribosome trait

28 Transcription from DNA nucleic acid language to RNA nucleic acid language

29 RNA ribose sugar N-bases – uracil instead of thymine – U : A – C : G single stranded lots of RNAs – mRNA, tRNA, rRNA, siRNA… RNADNA transcription

30 Transcription Making mRNA – transcribed DNA strand = template strand – untranscribed DNA strand = coding strand same sequence as RNA – synthesis of complementary RNA strand transcription bubble – enzyme RNA polymerase template strand rewinding mRNA RNA polymerase unwinding coding strand DNA C C C C C C C C CC C G G G G GG GG G G G A A A AA A A A A A A A A T T T T T T T T T T T T UU build RNA 5 3

31 RNA polymerases 3 RNA polymerase enzymes – RNA polymerase 1 only transcribes rRNA genes makes ribosomes – RNA polymerase 2 transcribes genes into mRNA – RNA polymerase 3 only transcribes tRNA genes – each has a specific promoter sequence it recognizes

32 Which gene is read? Promoter region – binding site before beginning of gene – TATA box binding site – binding site for RNA polymerase & transcription factors Enhancer region – binding site far upstream of gene turns transcription on HIGH

33 Transcription Factors Initiation complex – transcription factors bind to promoter region suite of proteins which bind to DNA hormones? turn on or off transcription – trigger the binding of RNA polymerase to DNA

34 Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A 5'3'

35 Transcription video e.htm e.htm

36 Eukaryotic genes have junk! Eukaryotic genes are not continuous – exons = the real gene expressed / coding DNA – introns = the junk inbetween sequence eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

37 mRNA splicing eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA Post-transcriptional processing – eukaryotic mRNA needs work after transcription – primary transcript = pre-mRNA – mRNA splicing edit out introns – make mature mRNA transcript ~10,000 bases ~1,000 bases

38 1977 | 1993 Richard Roberts Philip Sharp CSHL MIT adenovirus common cold Discovery of exons/introns beta-thalassemia

39 Splicing must be accurate No room for mistakes! – a single base added or lost throws off the reading frame AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|

40 RNA splicing enzymes snRNPs exon intron snRNA 5'3' spliceosome exon excised intron 5' 3' lariat exon mature mRNA 5' No, not smurfs! snurps snRNPs – small nuclear RNA – proteins Spliceosome – several snRNPs – recognize splice site sequence cut & paste gene Whoa! I think we just broke a biological rule!

41 Alternative splicing Alternative mRNAs produced from same gene – when is an intron not an intron… – different segments treated as exons Starting to get hard to define a gene!

42 A A A A A 3' poly-A tail mRNA 5' 5' cap 3' G P P P As More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm – enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 GTP cap add poly-A tail – longer tail, mRNA lasts longer: produces more protein

43 mRNA processing video e.htm e.htm

44 mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome trait protein translation

45 Translation from nucleic acid language to amino acid language

46 How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? ATCG AUCG


48 Cracking the code 1960 | 1968 Crick – determined 3-letter (triplet) codon system Nirenberg & Khorana WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine

49 1960 | 1968 Marshall Nirenberg Har Khorana

50 The genetic code Code for ALL life! – strongest support for a common origin for all life Code is redundant – several codons for each amino acid – 3rd base wobble Start codon AUG methionine Stop codons UGA, UAA, UAG Why is the wobble good?

51 How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon UAC Met GCA Arg CAU Val

52 mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome trait protein translation

53 Transfer RNA structure Clover leaf structure – anticodon on clover leaf end – amino acid attached on 3 end

54 Loading tRNA Aminoacyl tRNA synthetase – enzyme which bonds amino acid to tRNA – bond requires energy ATP AMP bond is unstable so it can release amino acid at ribosome easily activating enzyme anticodon tRNA Trp binds to UGG condon of mRNA Trp mRNA ACC UGG C=O OH H2OH2O O tRNA Trp tryptophan attached to tRNA Trp C=O O

55 Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon – organelle or enzyme? Structure – ribosomal RNA (rRNA) & proteins – 2 subunits large small EP A

56 Ribosomes Met 5' 3' U U A C A G APE A site (aminoacyl-tRNA site) – holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) – holds tRNA carrying growing polypeptide chain E site (exit site) – empty tRNA leaves ribosome from exit site

57 Building a polypeptide Initiation – brings together mRNA, ribosome subunits, initiator tRNA Elongation – adding amino acids based on codon sequence Termination – end codon 123 Leu tRNA Met PEA mRNA 5' 3' U U A A A A C C C AU U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A C C A U U G G G A C Val Ser Ala Trp release factor A AA CC UUGG 3'

58 Translation video e.htm e.htm

59 Protein targeting Signal peptide – address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… start of a secretory pathway

60 Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' GTP cap poly-A tail large ribosomal subunit small ribosomal subunit aminoacyl tRNA synthetase EPA 5' 3' RNA polymerase exon intron tRNA

61 AAAAAAAAGTP 20-30b 3' promoter transcription stop transcription start introns The Transcriptional unit (gene?) transcriptional unit (gene) TACACT DNA TATA 5' RNA polymerase pre-mRNA 5'3' translation start translation stop mature mRNA 5'3' UTR exons enhancer b

62 Protein Synthesis in Prokaryotes Bacterial chromosome mRNA Cell wall Cell membrane Transcription Psssst… no nucleus!

63 Prokaryote vs. Eukaryote genes Prokaryotes – DNA in cytoplasm – circular chromosome – naked DNA – no proteins – no introns Eukaryotes – DNA in nucleus – linear chromosomes – DNA wound on histone proteins – introns vs. exons eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

64 Transcription & translation are simultaneous in bacteria – DNA is in cytoplasm – no mRNA editing – ribosomes read mRNA as it is being transcribed Translation in Prokaryotes

65 Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes – time & physical separation between processes takes eukaryote ~1 hour from DNA to protein – no RNA processing

66 Any Questions?? What color would a smurf turn if he held his breath?

Download ppt "Happy New Year -Grab a big whiteboard and a markers for your table."

Similar presentations

Ads by Google