Presentation is loading. Please wait.

Presentation is loading. Please wait.

Ghosh Lab University of Arizona Department of Chemistry.

Similar presentations

Presentation on theme: "Ghosh Lab University of Arizona Department of Chemistry."— Presentation transcript:

1 Ghosh Lab University of Arizona Department of Chemistry

2 Outline Cloning overview pDRAW32 Design Gene Insert Primers Further considerations (optimization of the process) Transformation

3 Cloning Overview Four main steps in cloning: Insert synthesis Restriction enzyme digest Ligation Transformation + Functional construct Plasmid (vector) Insert (your gene)

4 Design Overview Steps to follow in designing your cloning experiment: Design your gene Design your insert Pick your enzymes Check your design Recheck your design Functional construct

5 All of the important information in one place! pDRAW32 Plasmid maps: pDRAW32

6 pDRAW32 You can look at the sequence in detail Open reading frames Translation Restriction sites Complementary strand

7 Design of the Gene Example, the gene we want: G C D R A S P Y C G We got this from phage display: ggctgcgacagggcgagcccgtactgcggt G C D R A S P Y C G Phage sequence Final sequence for the gene of interest: ggctgcgacagggcgagcccgtactgcggttaa G C D R A S P Y C G * Add a stop codon If you are cloning out of a known plasmid, just use the sequence that you have

8 Design of the Gene If you are designing the gene from scratch, keep in mind codon usage Not all codons are created equal Un-optimized codons could lead to lower expression levels The codon usage reflects levels of tRNA available in E. Coli Pay attention to the stop codons too (XL1-Blues read through TAG {amber stop codon} 20% of the time)

9 or preferably… What if we dont have the DNA sequence? Design from scratch! (dont forget about codon usage)

10 Endonucleases (or restriction enzymes) are enzymes which cut DNA at specific internal recognition sequences Compare to exonucleases, which cut from one end You must choose restriction sites that are available in the plasmid you are cloning into They must not appear in your gene (silent mutation can remove unwanted sites in your designed gene) Choice of Restriction Sites/Enzymes Once you have your gene, you need to design a way to get it into your plasmid

11 Restriction sites must exist only once in your plasmid They must be in the correct position relative to the purification tag Restrictions sites usually add extra residues to your gene product; make sure they are compatible with your peptide/protein Some restriction sites are sub-optimal for cloning Blunt end sites dam and dcm methylation-affected enzymes Really Important Factors to Remember When Choosing Restriction Enzymes


13 dam Methylation Dam methylase Dam methylase puts a methyl group on the nitrogen of 6 th position of adenosine at the site: GATC All of the E. Coli that we use generate DNA with dam methylation Some enzymes only cut dam methylated DNA: eg DpnI Some enzymes do not cut dam methylated DNA: eg XbaI

14 dcm Methylation Dcm methylase Dcm methylase puts a methyl group on the carbon of 5 th position of cytidine at the site: CCAGG and CCTGG The enzyme we use most that can be affected by dcm methylation is SfiI XL1-Blues and BL21s are both Dcm +

15 Once you have your restriction enzymes chosen, it is time to design the final complete gene The multiple cloning site (or whatever plasmid you are cloning into) should already have the 5 portion of the gene intact (i.e. RBS, spacer, Met) Sequences must be in frame NcoI BtgI 51 CTTTAATAAG GAGATATACC ATGGGCAGCA GCCATCACCA TCATCACCAC M G S S H H H H H H SacI AscI SbfI SalI NotI BamHI EcoRI EcoICRI BssHII PstI AccI HindIII 101AGCCAGGATC CGAATTCGAG CTCGGCGCGC CTGCAGGTCG ACAAGCTTGC S Q D P N S S S A R L Q V D K L A Design of the Insert

16 71 ATGGGCAGCAGCCATCACCATCATCACCAC M G S S H H H H H H SacI AscI SbfI SalI BamHI EcoRI EcoICRI PstI AccI HindIII 101AGCCAGGATCCGAATTCGAGCTCGGCGCGCCTGCAGGTCGACAAGCTTGC S Q D P N S S S A R L Q V D K L A The gene we want: ggctgcgacagggcgagcccgtactgcggttaa G C D R A S P Y C G * BamHI PstI AGCCAGGATCCGAATTCGAGCTCGGCGCGCCTGCAGGTCGACAAGCTTGC S Q D P N S S S A R L Q V D K L A G C D R A S P Y C G * ggctgcgacagggcgagcccgtactgcggttaa AGCCAGGATCCGggctgcgacagggcgagcccgtactgcggttaaCTGCAGGTCGACAA Be aware of the amber stop codon: TAG Multiple cloning site

17 Design of the Insert Always check and re-check your sequence! ATGGGCAGCA GCCATCACCA TCATCACCAC AGCCAGGATCCGggctgcgacagggcgagcccgtactgcggttaaCTGCAGGTCGACAA atgggcagcagccatcaccatcatcaccacagccaggatccgggctgcgacagggcgagc M G S S H H H H H H S Q D P G C D R A S ccgtactgcggttaactgcaggtcgacaa P Y C G - L Q V D Everything looks good: in frame the whole way! Translate the whole gene

18 The wrong way to do it: AGCCAGGATCC ggctgcgacagggcgagcccgtactgcggttaaCTGCAGGTCGACAAGCTT atgggcagcagccatcaccatcatcaccacagccaggatccggctgcgacagggcgagcc M G S S H H H H H H S Q D P A A T G R A cgtactgcggttaactgcaggtcgacaagctt R T A V N C R S T S Frame shifted = garbage! Design of the Insert The gene is just inserted after the restriction site, which is out of frame with the plasmid-encoded start-codon/His-tag **Some plasmids, for whatever reason, have restriction sites out of frame with the translated gene**

19 Finishing Touches atgggcagcagccatcaccatcatcaccacagccaggatccgggctgcgacagggcgagc M G S S H H H H H H S Q D P G C D R A S ccgtactgcggttaactgcaggtcgacaa P Y C G - L Q V D Restriction enzymes need 5 and 3 base pairs to cut properly NEB has a reference guide for specific enzymes (see link below) A good rule of thumb is 6 base pairs after the recognition site Inserting a GC clamp at the end and beginning of the sequence is also a good idea gccagccaggatccgggctgcgacagggcgagcccgtactgcggttaactgcaggtcgacgc S Q D P G C D R A S P Y C G - L Q V D Final gene, polished and ready to go:

20 Once the insert is designed correctly, the next step is designing primers to order from IDT, based on insert synthesis strategy Design of the Primers Three main strategies towards insert synthesis: PCR amplification Klenow extension of overlapping primers Complimentary full-length primers + Insert Vector

21 The most common method of insert synthesis Necessitates a pre-existing construct Extra restriction sites and/or amino acid residues can be added on each side of the gene Internal mutations are more difficult PCR Amplification of Insert from an Existing Gene Insert

22 PCR amplification from overlapping primers No pre-existing construct is needed PCR products messy, possibly making subsequent rxns difficult Good for inserts >150 bp PCR Synthesis of Insert F1: 10x F2: 1x R1: 1x R2: 10x Full-length insert should still be the major product Insert

23 Klenow Extension of Overlapping Primers Two primers that are complimentary in their 3 region are designed (overlap 15bp) Extended to full length by the Klenow fragment of DNA Polymerase I Useful if insert is 50 to 150 bp Insert Klenow Klenow fragment: retains 3 to 5 polymerase activity, but does not have exonuclease activity

24 The simplest approach Order two primers that compliment each other Mix the two primers, heat, and aneal slowly (to ensure proper base-pairing) Feasible if the total insert size is < 60 bp Complimentary Full-Length Primers Insert Anneal

25 Designing Primers to Order Once the insert synthesis technique is decided, primer design is fairly straight-forward Forward primers: Assess necessary overlap and copy the sequence from your designed gene, along with extra 5 sequence Reverse primers: First, design exactly as if it were a forward primer: Copy necessary overlap and extra 3 sequence from your designed gene Once all this is in place, use pDRAW32 sequence manipulator to calculate the reverse compliment Order the pDRAW32 calculated sequence directly

26 Cloning Out an Existing Gene In the example mentioned previously, we would normally use full length overlapping primers, but lets look at the more common case of having a preexisting gene: gccagccaggatccgggctgcgacagggcgagcccgtactgcggttaactgcaggtcgacgc S Q D P G C D R A S P Y C G - L Q V D tgcggcccagccggccatgggctgcgacagggcgagcccgtactgcggtggaggcggtgctgcagcgc A A Q P A M G C D R A S P Y C G G G G A A A Preexisting gene: Goal gene: gccagccaggatccgggctgcgacaggccgtactgcggttaactgcaggtcgacgc Forward Primer:Design of Reverse Primer: + Overlap Extra sequence from gene design

27 gccagccaggatccgggctgcgacagggcgagcccgtactgcggttaactgcaggtcgacgc S Q D P G C D R A S P Y C G - L Q V D Ordering Primers Forward primer to order: gccagccaggatccgggctgcgacagg Reverse primer to order: GCGTCGACCTGCAGTTAACCGCAGTACGG Now we can order the primers: Design of Reverse Primer: ccgtactgcggttaactgcaggtcgacgc &

28 Vectors and Bacteria Strains VectorPromoterE Coli strains we use pQE-30T5 promoterXL1-Blue: mostly good for DNA isolation/phage display M15(pREP4): tighter regulation of the lac suppressor pMALPtac promoter pCANTAB-5EPlac promoter pET-Duet pRSF-Duet T7 lac promoter (An E. Coli strain with phage T7 RNA polymerase is necessary) BL-21: Protease deficient, stable to toxic proteins, and contains the T7 RNA polymerase gene An important thing to think about before you start cloning: What vectors/E Coli should I use?

29 lac site PromoterRBSATG- your gene lac repressor lac site PromoterRBSATG- your gene RNA polymerase X IPTG (or lactose, etc) IPTG lac site PromoterRBSATG- your gene Transcription mRNA lac Expression Regulation

30 Anti-biotic resistance (working concentration) Ampicillin (100 g/mL) Kanamycin (35 g/mL) Tetracycline HCl (10 g/mL) Chloramphenicol (170 g/mL in ethanol) Purification Tags and Selection (Anti-biotic Resistance) Purification Tag His-tag (nickel agarose resin) Maltose Binding Protein (amylose resin) Glutathione S-Transferase (glutathione resin)

31 Digestion of Insert and Vector Digest with the same restriction endonucleases Optional (recommended) step: Treat the plasmid DNA with Antarctic phosphatase Decreases the background by stopping self-ligation of singly cut plasmid and background re-ligation

32 Ligation of the Insert into the Vector + Ligation covalently attaches the vector and the insert via a phosphodiester bond (5phosphate and 3 hydroxyl of the next base)

33 Antarctic Phosphatase and Ligation Antarctic Phosphatase cleaves this phosphate, disallowing self-ligation The insert still has the 5 phosphate though

34 Transformation The functional construct is now ready to be transformed into new E. Coli and grown up The new DNA isolated from the E. Coli must then be sequenced to make sure that everything worked Once the sequence is confirmed, we are ready to go!

Download ppt "Ghosh Lab University of Arizona Department of Chemistry."

Similar presentations

Ads by Google