Presentation is loading. Please wait.

Presentation is loading. Please wait.

Suppl. Fig. 1 AB HPDE PANC1 Suit028 Suit007CapanI PaTu 8988t MonoMac 6 TGF Actin.

Similar presentations


Presentation on theme: "Suppl. Fig. 1 AB HPDE PANC1 Suit028 Suit007CapanI PaTu 8988t MonoMac 6 TGF Actin."— Presentation transcript:

1 Suppl. Fig. 1 AB HPDE PANC1 Suit028 Suit007CapanI PaTu 8988t MonoMac 6 TGF Actin

2 A Suppl. Fig. 2 empty vector CUX1 β-Actin E D CUX1 β -Actin untreatedCtrl siRNACUX1 siRNA #1 CUX1 siRNA #2 CUX1 siRNA #3 BC CXCL10CCL5

3 NFkB p65 0 2 4 24 LVCUX1 CUX1 STAT1 β-Actin STAT3 STAT6 NFkB p50 Phospho Stat3 (Ser727) phosphoNFkBp65 (Ser536) A Suppl. Fig. 3 TNF (incubation time in hours)

4 β -Actin STAT1 STAT3 STAT6 LV- LV+CUX- CUX+ LV-LV+ CUX- CUX+ Nucleus Cytoplasma CUX1 MEK1 ORC2 B Suppl. Fig. 3

5 Suppl. Fig. 4 human mouse -200 ACCTCACTCGTTAAAAATTAAAAGGAGCACAAGAGGGG-AGAGGGAAATTCC--AAGTTCATGGGTCACAATAAACACAAGCAATGCCCTCG-GTTT---ACAGGGGACTTCCCTCGGGT -212 ACCTAATTCACTATTACCAAAAA--------------AAGAGGAGCAGAGGGAAATTCCGTAACTTGGAGGCT-ACAATAAATA------ATACCTTCGAGTCTGCAACATGGGACTTCCCCAGGA---- human mouse -------T-GC--GGAGCCTT-GCTGAGTCATCTCCAAAGTC---AGCCAATCAGGACTCAGGGAGGGAAACT--CTTTGCAGATAAATA---CTC -10 ACAGCCAGCAGGTTTTGCTAAGTCAACTGTAATGCCCTTATCCAATCAGAATT-AGGGAGGGAAAATGGCTTTGCAGATAAATATGGCAC -18 CXCL10 CXCL10-1 for CXCL10-1 rev CXCL10-2 for CXCL10-2 rev Oligo-1 Oligo-2 Green: putative CUX1 binding site Red: putative NF-kB binding sites Solid lines: qPCR primer for ChIP Dashed lines: Oligonucleotides for DNA-pulldown

6 Suppl. Fig. 5 A * BC merge DAPI Granzyme B CD8


Download ppt "Suppl. Fig. 1 AB HPDE PANC1 Suit028 Suit007CapanI PaTu 8988t MonoMac 6 TGF Actin."

Similar presentations


Ads by Google