1. RNA AND PROTEIN SYNTHESIS

2. How your cell makes very important proteins proteinsThe production (synthesis) of proteins. 2 phases2 phases: 1.Transcription (RNA copy of DNA) 2.Translation DNA → RNA → ProteinDNA → RNA → Protein

3. DNA → RNA → Protein Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

4. Before making proteins, Your cell must first make RNA Question:Question: RNA(ribonucleic acid) DNA (deoxyribonucleic acid)How does RNA (ribonucleic acid) differ from DNA (deoxyribonucleic acid)?

5. RNADNA RNA differs from DNA RNAsugar ribose 1.RNA has a sugar ribose DNAsugar deoxyribose DNA has a sugar deoxyribose RNAuracil (U) 2.RNA contains uracil (U) DNAthymine (T) DNA has thymine (T) RNAsingle-stranded 3.RNA molecule is single-stranded DNAdouble-stranded DNA is double-stranded

7. 1. Transcription (mRNA production) RNA molecules are produced by copying part of DNA into a complementary sequence of RNA This process is started and controlled by an enzyme called RNA polymerase.

8. 1. Transcription DNA strandsRNAThen RNA Polymerase moves along one of the DNA strands and links RNA nucleotides together.DNAmRNA RNA Polymerase

9. http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/transcripti on.swf

10. Question: RNADNAWhat would be the complementary RNA strand for the following DNA sequence? CGCAUAC DNA 5’-GCGTATG-3’DNA 5’-GCGTATG-3’

11. Types of RNA Three types ofRNAThree types of RNA: A.messenger RNA (mRNA) B.transfer RNA (tRNA) C.ribosome RNA (rRNA) Remember: all produced in the nucleus!Remember: all produced in the nucleus!

12. mRNA Carries instructions from DNA to the rest of the ribosome. Tells the ribosome what kind of protein to make Acts like an email from the principal to the cafeteria lady.

13. A. Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codonprotein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7 codon 1

14. If the cell is a school… The Nucleus is the school officeThe Nucleus is the school office The Nucleolus is the principal’s officeThe Nucleolus is the principal’s office The DNA is the principalThe DNA is the principal Ribosomes are the cafeteria ladiesRibosomes are the cafeteria ladies mRNA is the email from the principal to the cafeteria ladymRNA is the email from the principal to the cafeteria lady

15. rRNA Part of the structure of a ribosome Helps in protein production tRNA A go-getter. obtains and carries the amino acids to the appropriate area to make the right protein according to mRNA instructions

16. B. Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid

17. 3. Translation - making proteins Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell

18. 3. Translation Three parts: initiation 1.initiation: start codon (AUG) elongation 2.elongation: termination 3.termination: stop codon (UAG) PROTEIN!!!!Let’s make a PROTEIN!!!!.

19. Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

20. 3. Translation P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG

21. Initiation mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

22. mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

23. mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

24. mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

25. mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

26. mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

27. mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

28. mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

29. End Product primary structure of a proteinThe end products of protein synthesis is a primary structure of a protein. amino acid peptide bondsA sequence of amino acid bonded together by peptide bonds. aa1 aa2 aa3 aa4 aa5 aa200 aa199

30. http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/translation.swf

31. Question: The anticodon UAC belongs to a tRNA that recognizes and binds to a particular amino acid.The anticodon UAC belongs to a tRNA that recognizes and binds to a particular amino acid. What would be the DNA base code for this amino acid?What would be the DNA base code for this amino acid?

32. Answer: tRNA - UAC (anticodon)tRNA - UAC (anticodon) mRNA- AUG (codon)mRNA- AUG (codon) DNA - TACDNA - TAC