1. 1. What does DNA stand for? 2. What shape does the DNA molecule have? 3. What does DNA do for your cells? 4. Why is DNA important to you? Stamp Sheet: DNA: The Genetic Material

2. A. DNA—Deoxyribonucleic Acid 1. DNA has a Double Helix shape 2. The shape was discovered by James Watson and Francis Crick in 1953

4. 3. Had help from Rosalind Franklin and her X-ray crystallography pictures of DNA

6. B. DNA is a polymer made of monomers called nucleotides 1. Nucleotides (monomers)are made of three parts: a. phosphate group, b. sugar (deoxyribose) c. nitrogen-containing base 2. The 5-carbon sugar in DNA is Deoxyribose Deoxyribose Notice the negative charge

7. 3. There are four Nitrogen-Containing Bases: a. Adenine (purine) b. Guanine (purine) c. Thymine (pyrimidine) d. Cytosine (pyrimidine)

8. Pyrimidines: Purines: Thymine and Cytosine Adenine and Guanine (Single ringed) (Double ringed)

9. 4. Chargraff’s Rule: The number of Thymine = the number of Adenine The number of Guanine = the number of Cytosine If a strand of DNA is composed of 20% Guanine then it also contains 20% Cytosine. The same strand of DNA would also be composed of 30% Thymine and 30% Adenine. What does this suggest about how the bases fit together?

10. 5. Chargraff’s rule leads to Base pairing rules: G pairs with C and A pairs with T (GCAT)

11. C. The double helix shape is antiparallel 1. One strand is 5’ to 3’ the other is 3’to 5’ 2. The Bases are bonded together with hydrogen bonds Hydrogen Bonds hold the bases together down the middle

12. 3. The order of the bases acts as a genetic code

13. ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCGGTTACTG CCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGA GGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAG AGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGC AGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAA GTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACA ACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTG TGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTG GGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCA AAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGT GGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCAC TAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCC TTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATG AAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAA CATTTATTTTCATTGC

14. The sequence of bases on your DNA give you your characteristics

15. D. Organization of DNA inside of a cell 1. DNA is found in the nucleus 2. DNA is wrapped around proteins called histones DNA and 8 histones = Nucleosome

17. 3. Most of the time DNA exists in the nucleus as Chromatin 4. During Cell Division, chromatin condenses to form Chromosomes

20. 5. Most Humans have 46 chromosomes in each cell a. These 46 chromosomes contain all the genetic information that makes you.

22. 7. A gene is a segment of DNA with a specific sequence of bases that codes for a specific protein. 8. Introns are NONCODING regions of a gene that get removed 9. Exons are coding regions of a gene that tell the cell what protein to make