1. Application of Genetic Markers to Dairy Cattle

2. Overview Traditional selection Genetic markers Granddaughter design Resource populations QTL identification EST sequencing

3. Introduction Traditional dairy cattle breeding has assumed that an infinite number of genes each with very small effect control most traits of interest Logical to expect some “ major ” genes with large effect; these genes are usually called quantitative trait loci (QTL) The QTL locations are unknown! Genetic markers can provide information about QTL

4. Traditional Selection Programs Estimate genetic merit for animals in a population Select superior animals as parents of future generations

5. Genetic Improvement: Challenges and Technologies Traditional selection Gene mapping and marker assisted selection Transgenics Abundant Genetic variation Limited genetic variation Little or no genetic variation

6. Application of Genetic Markers Identify genetic markers that are associated with changes in genetic merit Use marker assisted selection (MAS) to make selection decisions before phenotypes are available Adjust genetic merit for genetic markers

7. Useful Genetic Markers: Allow marker inheritance to be followed across generations Many different types of marker alleles well represented in the population Marker and QTL are close together so that recombination between marker and QTL is rare Best case is when we know the QTL - then it is the marker!

8. mq MQ Marker Locus Quantitative Trait Locus {{ Linkage Distance

9. Parental Chromosomes Recombinant Chromosomes Marker Locus Quantitative Trait Locus {{ mq Mq mQ MQ

10. Parental Chromosomes AB CDEF ab cde f Recombinant Chromosomes * * * * * * *

11. Genetic Markers

12. Genetic Markers!!

13. Genetic Markers

14. Bull Granddaughter Design

15. Sons

16. Granddaughter Design

17. DNA Genetic Merit Data

18. Resource Populations: Cooperative Dairy DNA Repository (CDDR) The CDDR is an ongoing collection of all bulls entering progeny tests Includes all breeds Useful for QTL mapping in dairy cattle using a granddaughter design and for complex pedigree analysis Currently (6/01): Six North American studs contributing semen 9789 bulls in the collection 128 families with at least 25 sons

19. Compare Genetic Merit QTL Identification

20. 3.51.7-0.1-2.5-6.20.7 QTL Identification Bull Sons

21. USDA-ARS Progress Over 160 markers studied in over 1000 animals from 8 families Evaluated all available traits: Conformation traits, M, F, P, SCS, PL, and calving ease Genome-wide scan across all families was recently completed

22. Marker Association Results ChromosomeTrait 3Protein Percentage 4Strength Body Depth 5Dairy Form 6 Protein Percentage 7Somatic Cell Score 12Foot Angle Rear Legs (Rear View) 14Fat Percentage Protein Percentatge Fore Udder Attachment Front Teat Placement 16Udder Depth 18Rump Angle 20Protein Percentatge 22Rump Angle 27 Dairy Form

23. Family 8 interval analysis results

24. What is an EST? ATG TAA mRNA ESTs AAAAAAAAA 5’ AAAAAAAAA TTTTTTTTTT 3’ 5’ 3’ 5’ 3’ cDNA Tissue Biopsy mRNA isolation RT-PCR Sequencing of cDNA clones Bioinformatics Bovine Sequence database

25. USDA-ARS Bovine EST Projects Initial goal: Single pass sequencing of 5 bovine cDNA libraries 4 axis libraries @ MARC = 80,000 EST 1 mammary library @ BARC = 10,000 EST Mammary cDNA library has stages from prepubertal, mid-gestation, late gestation, cholostrogenesis, lactation, infected lactation, and early and late involution. Sample diverse developmental stages and morphological cell types to maximize diversity and minimize redundancy

26. Status ARS EST sequencing GenBank dbEST database submissions: 231,577 total cattle gene-related sequences >150,000 cattle ESTs generated by USDA 120,745 cattle sequences 1-4BOV cDNA libraries (MARC) 23,202 cattle sequences 5BOV cDNA library (BARC)

27. EST Sequence Analysis & Assembly AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATACCTTAGGGTCAGCTTTAAGCCATACCTTAGGACATTACCTAGG AGCTTTAAGCCATACCTTAGGACATTACCTAGG GCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATACCTTAGGGTC AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATACCTTAGGGTCAGCTTTAAGCCATACCTTAGGAC AGCTTTAAGCCATACCTTAGGGTCAGCTTTAAGCCATACCTTAGGACATTACCTAGG TC EST1 EST2 EST3 EST4 TIGR Bovine Gene Index: Over 67,000 unique sequence elements

28. Unique Cattle Sequences Rat Gene Index 11,077 28,617 18,292 36,734 10,175 44,367 2,542 31,671 15,238 22,760 24,149 Human Gene Index Mouse Gene Index Human Golden Path TOGA Over 17,000 “no hit” bovine sequence elements.

29. Conclusions Marker assisted selection is an evolutionary improvement over traditional selection methods. It allows more accurate estimation genetic merit of animals Evidence of important QTL has been found EST sequencing has been very successful Lots of interesting findings from EST project that will need additional research