1. Humoral immunity Antibody structure Antibody diversity
B-cell activation
Antibody production
Effector mechanisms

2. Immunoglobulin (Ig) structure
2 heavy chains, 2 light chains
2 identical Ag binding sites
VL + VH
3 hypervariable CDRs
Constant portion binds:
complement
phagocyte receptors
chime model
Immunoglobulin fold

3. Antibody diversity
VDJ recombinase rearranges DNA during B-cell development
k light chain heavy chain
C (constant) segment C segments for each isotype
35 “V” segments 45 “V” segments
5 “J” segments 20 “D” segments
6 “J” segments
 light chain heavy chain
4C (constant) segments
30 “V” segments
4 “J” segments
True or False: Every cell in the human body has the same DNA sequence
FALSE! T and B cells do not have the same sequence as other cells; each type has a unique sequence
We need to recognize at least 105 to 106 different Ag…but we have only about 30,000 genes!
How can we produce the needed diversity??

4. Antibody diversity Combinatorial diversity
Selection of V, D and J segments
Junctional diversity
Removal of bases by exonucleases
Insertion of bases by TdT
P-nucleotides
CDR3 (most variable)
is at V(D)J junction
GACTACATACCATACCTACAGGCATACATCGAATGA V D
>1011 possible combinations, considering both combinatorial and junctional diversity
GACTACATACCAT ATACATCGAATGA
GACTACATAC ATCGAATGA
GACTACATACACATCGAATGA VD

5. Isotypes 1 heavy-chain gene Different constant regions: Cg → IgG
IgG, IgA,
IgD, IgE
IgM
Isotypes
1 heavy-chain gene
Different constant regions:
Cg → IgG
Cm → IgM
Ca → IgA
Ce → IgE
Cd → IgD

6. Isotypes IgG – major Ab, monomer IgA – secreted Ab, dimer
IgM – first Ab made, pentamer (monomer as Ag receptor)
IgE – parasites & allergies, monomer
IgD – Ag receptor, monomer

7. Antigen recognition B cells can recognize: Proteins Polysaccharides
Lipids
Nucleic acids
Small molecules (e.g., toxins)
(strongest response;
requires TH)
T-dependent
(weaker response
but no TH needed)
T-independent
What types of Ag can B cells recognize?
How are these responses classified?
Which response is stronger?

8. Antigen recognition
B cells find Ag in follicles of lymph nodes and spleen
“Filter” blood and lymph
Concentrate Ag
Ag enters in blood, lymph or transported by DC cells

9. Antigen recognition No Ag processing
Ag receptor (BCR) = membrane-bound IgM or IgD
Where do B cells encounter Ag?
Follicles of lymph nodes and spleen (B-cell area)

10. B-cell activation Receptor cross-linking required (multivalent Ag)
Signal transduction
poor activation
What is the receptor for Ag?
How does Ag initiate an activating signal?
Receptor cross-linking is required
One reason why a protein Ag produces a weaker response in absence of TH
Multivalent Ag (e.g., polysaccharide, whole organism, aggregate, etc.)
good activation

11. B-cell activation Proliferation
Expression of B7 and cytokine receptors
Migration out of follicles
Down-regulation of follicle chemokine receptors
Secretion of IgM
Migration away from B cell areas of follicles is needed to encounter T cells
Note that IgM is first Ab to be secreted (pentameric form)

12. B-cell activation Endocytosis, processing and display of Ag
APC for activated TH cells

13. B-cell activation Activated TH: CD40L Cytokines (IL-4, IFN-g, TGF-b)
Stimulates B cell:
Clonal expansion
Ab production
Isotype switching
Clonal Expansion

14. B-cell activation B and T cells can recognize different epitopes
protein Ag
polysaccharide Ag
epitope of
protein Ag
B cell
TH cell

15. Differentiation Plasma cells Reside in lymph node Secrete Ab
Memory cells
Reside in bone marrow
Secrete Ab at low level
Activate quickly on re-exposure
plasma cell

16. Affinity maturation
Ab made later in infection has higher affinity for Ag
Even higher affinity in secondary response
In what sense do we make “better” antibody as the response to infection progresses?

17. Affinity maturation
Some activated B cells enter follicles → germinal centers
Proliferation
Hypermutation of V domains (1 mutation/1000 bp/cell/generation)

18. Follicular dendritic cell (FDC)
Affinity maturation
Germinal center B cells die unless they interact with FDCs
As [Ag] decreases, competition selects for increased affinity Ag Ab
Fc receptor DC
Follicular dendritic cell (FDC)

19. Antibody feedback Fc receptors on B cells
When Ab levels are high, B cell binds Ab-Ag complex
Fc receptor blocks receptor signalling

20. How do antibodies work? V: antigen binding CH2: Fc receptor binding
complement binding
CH3: Fc receptor binding

21. Antibody functions Neutralization Opsonization
Antibody-dependent cell-mediated cytotoxicity (ADCC)
Activation of complement
Specialized roles:
Mucosal immunity
Neonatal immunity

22. Neutralization What is it? Bind virus, cell or toxin
Requirements:
Ig classes:
Effective against:
Bind virus, cell or toxin
Prevent attachment to cell or receptor
Ab only
IgM, IgG, IgA
viruses and toxins especially
can be effective against bacteria

23. Opsonization What is it? Requirements: Ig classes: Effective against:
Coat microbe (opsonin)
Enhance phagocytosis
Ab, phagocyte with FcgRI receptor
IgG (IgG1 and IgG3)
bacteria, especially with capsules
viruses when extracellular

24. ADCC What is it? Requirements: Ig classes: Effective against:
Target NK cell or eosinophil
to infected cell or parasite
Ab, NK (FcgRIII) or eosinophil (FCeRI)
IgG for NK, IgE for eosinophils
intracellular pathogens, parasites

25. Activation of complement
Ab (IgG or IgM) binds Ag
C1 binds two adjacent Fc regions
Proteolytic activation of complement proteins
Opsonization (C3b)
Activation of B cells (C3d)
Inflammation (C5b)
Bacterial lysis (MAC)

26. Mucosal immunity What is it? Requirements: Ig classes:
Effective against:
Secretion of Ab into respiratory and
gastrointestinal tracts
Ab, epithelium with poly-Ig receptor
IgA
bacteria, viruses and toxins

27. Neonatal immunity What is it? Requirements: Ig classes:
Effective against:
Passive immunity protects newborn
during development of immune system
Ab, newborn cells with FcRn
IgG via placenta, IgA and IgG in milk
bacteria, viruses and toxins
(depends on mother’s immunity)