1. Getting Started: What is DNA? Concepts/Vocabulary: – DNA – Nucleotide – Triplet/Codon

2. Getting Started:

3. DNA is made up of 3 parts: 1. Nitrogenous Base: Aka nucleotide Adenine (A), Thymine (T), Guanine (G), Cytosine (C) 2. 5 Carbon Sugar Deoxyribose 3. Phosphate group

4. Getting Started: DNA stands for Deoxyribonucleic Acid. – Let’s break it down: “Deoxyribo” refers to the sugar that makes up much of the DNA molecule. Nucleic refers to the fact that DNA is found in the nucleus of most Eukaryotic organisms Acid refers to the fact that the DNA molecule, when dissolved in pure water makes the water slightly acidic (due to the phosphate group).

5. Getting Started:

6. 3’5’ TACGTACGGCAATCGATTACGTACGGCAATCGAT ATGCATGCCGTTAGCTAATGCATGCCGTTAGCTA 5’3’ Three nucleotides in a row are called a triplet and/or codon. Each triplet codes for an amino acid. Amino acids are combined in the ribosomes of cells to create proteins. Proteins are essential to living organisms and part of every process that takes place within a cell.