Presentation is loading. Please wait.

Presentation is loading. Please wait.

Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology.

Similar presentations


Presentation on theme: "Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology."— Presentation transcript:

1 Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology

2 Introduction chromosome mutations (involve larger segments) & DNA mutations (changes in the sequence) DNA mutations (changes in the sequence) Two distinct types of mutations: Two distinct types of mutations:

3 Introduction Key terms: Mutation - Mutagen - Change in the genetic code (DNA sequence) Agents responsible for the generation of mutations Carcinogen - Agents causing cancer

4 * Mutagenic effect Mutated DNA molecule Mutagens  Environmental agents: Spontaneous  Spontaneous : Chemical mutagens, nuclear radiation, UV-radiation (sunlight) Mistakes occurring during the DNA replication, „hot-spots”

5 * Mutagenic effect Repaired DNA molecule      ** ** ** Mutated DNA molecule

6 The flow of the genetic information Transcription DNA Translation *mRNA protein DNA mRNA mutated protein Normal function Altered function, no function, disease …

7 Different types – different outcomes 1, Single base substitutions (point mutations) 2, Frameshift mutations:

8 Different types – different outcomes 1, Single base substitutions (point mutations) Nonsense mutations Convert an amino-acid specifying codon to a STOP (termination codon, TAA,TAG,TGA) … … CAC CAG GCA … Normal sequence Mutant sequence … … His Gln Ala … … … CAC TAG GCA … … … His STOP. position: 498 Normal protein: 1480 amino acids Mutant protein: 498 amino acids Short protein > no function!

9 Different types – different outcomes 1, Single base substitutions (point mutations) Missense mutations Result in replacement of one amino-acid by another Example (sickle-cell disease): … ACT CCT GAG GAG … … Thr Pro Glu Glu … Normal  -chain of hemoglobin (HbA) Mutant  -chain of hemoglobin (HbS) … ACT CCT GTG GAG … … Thr Pro Val Glu … NORMAL RED BLOOD CELLS SICKLE RED BLOOD CELLS

10 This single mutation (A>T) is responsible for the development of sickle cell anemia

11 Different types – different outcomes 1, Single base substitutions (point mutations) Silent mutations Result in no change in the protein product TCT > Serine TCA > Serine TCG > Serine TCC > Serine Mutation: Result in a substitution of a closely related amino acid or

12 Different types – different outcomes 1, Single base substitutions (point mutations) 2, Frameshift mutations:

13 Different types – different outcomes 2, Frameshift mutations: Result from the insertion or deletion of one or two nucleotidesand causes an alteration of the reading frame nucleotides and causes an alteration of the reading frame Example: Original reading frame New reading frame Only 1 base insertion > completely diff. amino acid sequence ! met ala leu trp ile arg phe ile arg ATGGCCCTGTGGATCCGCTTCATTAGG… met ser pro val asp pro leu his stop GCCCTGTGGATCCGCTTCATTAGG… ATG A

14 Summary - DNA mutations Mutations: Mutations: changes in the nucleotide sequence of the DNA Cause: Cause: mutagens > environmental (chemicals, radiations,…) spontaneous mut. (errors during the DNA repl.) Types: Types: base substitutions > (missense, nonsense, silent) frameshift mutations (insertions, deletions) Consequences: Consequences: altered function, destroyed function, altered phenotype, disease… … provide the variation necessary for evolution (see evolution)


Download ppt "Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology."

Similar presentations


Ads by Google