Presentation is loading. Please wait.

Presentation is loading. Please wait.

Cold Tolerance in Vaccinium corymbosum Shamita Punjabi Lab Methods in Genomics BIO 343 Davidson College.

Similar presentations


Presentation on theme: "Cold Tolerance in Vaccinium corymbosum Shamita Punjabi Lab Methods in Genomics BIO 343 Davidson College."— Presentation transcript:

1 Cold Tolerance in Vaccinium corymbosum Shamita Punjabi Lab Methods in Genomics BIO 343 Davidson College

2 Starting point: CBF genes Polashock et al (2010)Polashock et al (2010) The CBF (C-repeat binding factor) genes have a host of downstream targets that help plants acclimate to the cold CBF genes are found in many species and are therefore a good target for understanding how cold acclimation can occur in a variety of plants

3 CBFs and COR genes in other species Cold Acclimation/Freezing Tolerance in Blueberries Polashock et al (2010) -COR6.6 -COR78 -COR15A etc.. Polashock et al (2010) Frost Tolerance in Temperate Cereals Galiba et al (2009) -FR2 -TaCBF14 -TaCBF15 Galiba et al (2009) Cold Tolerance in Eucalyptus Species Navarro et al (2009) -EguCBF1c -EguCBF1d Navarro et al (2009) Cold Tolerance signaling in Arabidopsis Lissarre et al, 2010 -ICE1 -ICE2 Zhou et al, 2010 Lissarre et al, 2010 Zhou et al, 2010 -SIZ1

4 Research Scheme Choose at least 1 CBF gene and 1 other frost tolerance gene to find in blueberry Obtained mRNA sequences for the EguCBF1c in Eucalyptus, TaCBF14 in common wheat and ICE1 and SIZ1 in Arabidopsis from NCBI Use tBLASTx in Vaccinium Database to find matches of mRNA sequences to amino acid sequences of blueberry scaffolds Submit best scaffolds to SSR database and choose primers based on vicinity to gene matches on scaffold Ultimately, devise a schematic pathway for activation of cold tolerance genes in blueberry Links to Sequences for all genes used are provided on the Wiki

5 Primers from SSR Search EguCBF1c & TaCBF14 3 Primer Matches on Scaffold 00009 (~488,000 bp) E score = 2e-17 Forward Primer: AGTTCTAAACCGATTGTGCGTT Reverse Primer: AATTCCAACCTAACTGCCAGAA TG 10x @ 479,956 bp, Product: 291 bp Forward Primer: TCTCTCTCAGATCTCTGATCCGT Reverse Primer: AAAGCAAGAAGAGAAATGGTGG TCT 5x @ 479,466 bp, Product: 110 bp Forward Primer: AATCTGCAAATCTCCATCACCT Reverse Primer: TCCTAAAAACCAAAGCATGTCC CT 11x @ 463,925 bp, Product: 226 bp

6 3 Primer Matches on Scaffold 00051 (~55,000 - 60,000 bp) E score = 4e-80 Forward Primer: CGCATCTTTACTCCACTAACCC Reverse Primer: AATCCCTGCTGTGTATCTTGGT TC 5x @ 55,088 bp, Product: 127 bp Forward Primer: GTGGGGAGCAAACTCACTAATC Reverse Primer: AATAACAAAAACTCGCTCTCGC CA 5x @ 67,058 bp, Product: 186 bp Forward Primer: GAGAAGTGAAGGAATGGAGGTG Reverse Primer: CGAAATGGGTTCACTCTCTACC TGT 4x @ 60,104 bp, Product: 259 bp Primers from SSR Search ICE1

7 Primers from SSR Search SIZ1 3 Primer Matches on Scaffold 00717 (~85,000 - 107,000 bp) E score = 0.0 Forward Primer: AAGCCGCATATTAGAGCGTATC Reverse Primer: CCTCCCTCCTCTCTCTCTCTCT AG 21x @ 86,562 bp, Product: 300 bp Forward Primer: ATTGCAATCTTGCACAGAGAGA Reverse Primer: CTACATAGGATACGCATTGGCA AG 13x @ 86,761 bp, Product: 279 bp Forward Primer: CATTTGTACCCCCTCAAGTAGC Reverse Primer: TTTCCCTAGTGGTGAAGTGTGA GA 6x @ 107,162 bp, Product: 157 bp

8 Phospholipid Signaling Pathway Byeong-ha Lee et al used microarrays to find genes induced and repressed in cold environments Byeong-ha Lee et al Phospholipid signaling is one of many pathways is affected by CBF transcription factors Early induced genes: IP5PII and ADTGK1 Late induced genes: IPK2a KEGG Map for “phosphatidylinositol signaling” includes all of these genes

9 Primers from SSR Search IP5PII (3.1.3.56) 3 Primer Matches on Scaffold 00661 (~93,000-105,000) E score = e-154 Forward Primer: GATTCGAACGGCAGTATAAACC Reverse Primer: GCCCTTATCAATCTCCAAATGA AT 6x @ 106,789, Product: 222 bp Forward Primer: ATGGAGTACCAAGGAAAAACGA Reverse Primer: CCATTTTTATCGGGGTGAGTAA TC 13x @ 81,787, Product: 246 bp Forward Primer: TCTCTTCTACTGTCAGAGGCCC Reverse Primer: CACTCTGTTTGGAAAATGTGGA ATA 5x @ 86,548, Product: 231 bp

10 Primers from SSR Search ATDGK1 (2.7.1.107) 3 Primer Matches on Scaffold 00019 (~355,000-360,000) E score = 0.0 Forward Primer: CTAGCCTACCAACTACCTCCGA Reverse Primer: GGATTGCTTCTCTGTTTCTGCT AG 7x @ 352,411, Product: 214 bp Forward Primer: AGCAGAAACAGAGAAGCAATCC Reverse Primer: CAAGGCAAACCCTAGAGAGAGA CT 11x @ 352,582, Product: 143 bp Forward Primer: TTGAACATGCTCTTGAATCCTG Reverse Primer: TACGTGAGTATCATCCACAGCC AATA 4x @ 355,495, Product: 131 bp

11 Primers from SSR Search IPK2a (2.7.1.107) 4 Primer Matches on Scaffold 00135 (~2,000-3,000) E score = 4e-81 Forward Primer: AATCAATCAGTTGACATGCGTC Reverse Primer: GCTTAAAGCTTAACAAGCCCAA CT 5x @ 7,764, Product: 197 bp Forward Primer: ATCTAAATGTTTAATCGGGGGC Reverse Primer: ATCTAGGGAGACTGTTGGGGAT TG 6x @ 17,950, Product: 143 bp Forward Primer: CCAATGCTGCTTCACTGTACTC Reverse Primer: TACTTGTCGGTTGCAGATTCAC AAAC 3x @ 7,124, Product: 229 bp Forward Primer: ACCCATCCGAGGTATGTTACAG Reverse Primer: AAAGATTAAAGGCGGATAAGGC TTCGG 3x @ 791, Product: 108 bp

12 KEGG Map for Phosphatidylinositol signaling pathway

13 Rough Scheme of Blueberry Cold Response Pathway CBF COLD! ICE1 (Sumoylation) IP5PII ADTGK1 IPK2a SIZ1 Primers via SSR search have been provided for all subjects above

14


Download ppt "Cold Tolerance in Vaccinium corymbosum Shamita Punjabi Lab Methods in Genomics BIO 343 Davidson College."

Similar presentations


Ads by Google