The evolution of sex chromosomes: similarities and differences between plants and animals Deborah Charlesworth Institute of Evolutionary Biology, University.

The evolution of sex chromosomes: similarities and differences between plants and animals
Deborah Charlesworth Institute of Evolutionary Biology, University of Edinburgh Papaya female Silene dioica male Silene latifolia female

1. WHAT are sex chromosomes?
and what are NOT sex chromosomes 2. WHY do sex chromosomes evolve loss of recombination? 3. WHEN did sex chromosomes of some important species evolve? and when did recombination stop? and 4. HOW did recombination stop? 5. WHERE are the sex-determining loci in relation to the regions where recombination is absent? 6. WHAT are the consequences for sex chromosomes of stopping recombination?

Sex chromosomes have been known to geneticists for a long time
Muller (1914): reviewed evidence for X-Y pairing (indicating their homology) and Y genetic degeneration (suggested by C.W. Metz) and discussed recessive loss of function mutations as the cause of degeneration Haldane (1922, p. 107): “If sex were determined by a single factor, it is very difficult to see what advantage there could be in its being linked with other factors)” An excellent review of the classical work is JJ Bull’s book “Evolution of Sex Determining Mechanisms” but many important things have only become clear very recently, and great progress is occurring Lahn and Page (1999): human genome sequence reveals sequences of genes shared between X and Y, often highly diverged. Carvalho (2001): Drosophila Y-linked genes Recent data are starting to help us understand why and how recombination gets stopped between the X and Y (and what the consequences are) Further evolutionary changes of sex chromosomes can now be studied in detail

Classical sex chromosomes
Humans Y is ~ 1/3 of the size of the X X Y X ~ 1,098 genes Y 24 genes Male-specific Y region MSY without recombination Pseudo-autosomal region PAR In Drosophila, the Y is about the same size as the X, but the X has several thousand genes, while the Y has around 20. No X gene has a Y homologue.

Some species, including many plants have small sex-determining regions
Several plant ‘sex chromosomes’ have the sex-determining genes located within a small region (blue; only 10% of chromosome 1 of papaya) where recombination does not occur (Liu et al. 2004) Some fish sex chromosomes may be similar Does small size mean young, or primitive? Other plants have heteromorphic sex chromosomes like those of humans and Drosophila, or neo-sex chromosomes Liu et al Nature 427: neo-sex chromosomes also occur in plants

Some highly heteromorphic plant sex chromosomes
Silene latifolia MSY region PAR X Y The liverwort, Marchantia polymorpha (haploid) X Yamato et al. (2007) Proc. Natl. Acad. Sci. USA 104, Y

Haploid sex chromosomes in a bryophyte with separate sexes (Ceratodon purpureus)
Meiosis 2n → n Diploid sporophyte XY AA NOTE No XX Genetic map showing 15 linkage groups, including the XY chromosome pair (121 AFLP, 3 genic markers ) Fertilization n → 2n Haploid Y A Male gametophyte X A Female gametophyte McDaniel et al Genetics 176:

Neo-sex chromosomes due to Fusions/translocations
Autosome Y Y-autosome fusion X-autosome fusion neo-X neo-X or X2 X1 Y1 neo-Y or Y2 neo-Y Chromosome(s) transmitted to female progeny Chromosome(s) transmitted to male progeny In Drosophila, there is no recombination in males Thus, both kinds of fusion create non-recombining neo-sex chromosomes Chromosome fusions can lead to heteromorphism Fusion can also occur in X0 systems

Neo sex chromosomes in the genus Drosophila
Complete degeneration of the ancestral Y Carvalho, A. B., and A. G. Clark Y chromosome of D. pseudoobscura is not homologous to the ancestral Drosophila Y. Science 307:

Neo-sex chromosomes occur in many species
Rowell, D. (1985). Complex sex-linked fusion heterozygosity in the Australian huntsman spider Delena cancerides (Araneae: Sparassidae). Chromosoma 93, RENS et al., 2004 PNAS 101: GRÜZNER et al., 2004 Nature 432:

The mammalian sex chromosomes evolved via a fusion since the split from marsupials
The Y can be lost entirely if genes required for male fertility can move to a different chromosome Some species have X/0 male genotype, but males are still fertile, e.g. Drosophila affinis In D. pseudoobscura, the X chromosome has been fused to an autosome, and the Y has lost all male fertility genes So, even if the Y chromosome degenerates, we do not need to worry about a future without males Clearly, the Y cannot be lost unless the sex-determination function is replaced by a new gene (or the Y gene moves to another chromosome) Such changes are theoretically possible: e.g. DOORN and KIRKPATRICK, 2007 Turnover of sex chromosomes induced by sexual conflict. Nature 449: , KOZIELSKA et al., 2010 Segregation distortion and the evolution of sex-determining mechanisms. Heredity 104, autosome in marsupials X Y marsupial X

Changes can occur from XY to ZW system (even in different populations of the same species)
An example of the use of genes to demonstrate that the XY pair of chromosomes changed into a ZW pair Uno et al Comparative chromosome mapping of sex-linked genes and identification of sex chromosomal rearrangements in the Japanese wrinkled frog (Rana rugosa, Ranidae) with ZW and XY sex chromosome systems. Chromosome Research:1217-7

Summary of diversity of sex-determining chromosomes
CLASSICAL Non-recombining over a large genome region, with small “pseudo-autosomal region(s)”, e.g. mammal and Drosophila X and Y, bird and Lepidopteran Z and W Genetically degenerated loss of genes relative to the X (or lower function — see later) The Y can sometimes be totally lost (X0 systems) Y is enriched in male-function genes, and is rearranged relative to the X “LOCAL SEX-DETERMINING REGION” Chromosome is largely pseudo-autosomal The same properties as classical sex chromosomes, in a restricted region of genome We know much less about these, and modern molecular approaches are helping get information HAPLOID Haploid male genotype is Y and female is X NOT SEX CHROMOSOMES single-gene systems, e.g. sex-determination factor that replaced a previous one, honeybee complementary sex-determiner plant, fungal and algal incompatibility regions (but have some similar properties)

Environmental sex-determination
Monoecious Hermaphrodite Environmental sex-determination Mutation to loss of ♂ or ♀specific developmental pathway ♂-sterility mutation Genetically + environmentally determined unisexuals Gynodioecious (♀and hermaphrodite) Hermaphrodite Female Silene vulgaris ♀-sterility mutation GSD dioecy (♂ and ♀) X Y Proto-sex chromosomes Non-recombining region Replacement by new sex-determining gene Translocation onto another chromosome Mutation to sexually antagonistic gene New non-recombining region evolves

Possible origins of sex-determining chromosomes

2. WHY does recombination stop on sex chromosomes?
Haldane (1922, p. 107): “If sex were determined by a single factor, it is very difficult to see what advantage there could be in its being linked with other factors)” (Sex ratio and unisexual sterility in hybrid animals. J. Genetics 12: ) Nei (1969, 1970): models for lack of recombination and consequent accumulation of detrimental mutations leading to degeneration Nei, M Linkage modification and sex difference in recombination. Genetics 63: ; Accumulation of nonfunctional genes on sheltered chromosomes. American Naturalist 104: But many modern authors are much less clear e.g. “heteromorphic sex chromosomes have evolved ….when one autosome develops a dominant sex-determining mutation” Itoh et al Molecular cloning of zebra finch W chromosome repetitive sequences: evolution of the avian W chromosome. Chromosoma 117:

Why are 2 genes involved? In many plants, males and females are simply hermaphrodites with parts missing. In S. latifolia, sex-determination is genetically simple. Mutants support the hypothesis that at least 2 genes are involved 1. Loss of stamen promoting factor (SPF or M) creates females 2. Gynoecium suppressing factor (GSF or SuFemale) reduces female functions Hermaphrodite Picture from Shigeyuki Kawano Neuter

slightly older proto-Y, with MSY region
The simple 2 gene evolutionary model suggests that (1) sex determining loci must initially be linked for separate sexes to evolve 1 2 and (2) once females are present, hermaphrodites are selected to re-allocate more to male and less to female functions M SuFemale “proto-Y” “proto-X” m f Selection should then act to reduce recombination between the initial 2 genes slightly older proto-Y, with MSY region M2 M SuFemale

Summary of question 2: There is no selection to reduce recombination unless at least 2 genes interact Qvarnstrom & Bailey Heredity 102:4-15 are completely wrong! The evolution of identifiable heteromorphic sex chromosomes is initiated by the spread of a sex-determining gene. This occurs when a new mutation at a locus leads all its carriers to become the same (subsequently heterogametic) sex, with the chromosome carrying this mutation becoming the Y/W chromosome. In eutherian mammals, for example, the development of males is controlled by the SRY gene found only on the Y chromosome Here is another misunderstanding (Sekido & Lovell-Badge Tr. Genet. 25:19-29) In eutheria, Sox3 is X linked and involved in the development of the CNS, the pituitary, pharyngeal region and is perhaps involved in male fertility, but it has no demonstrable role in sex determination. The original mutation that led to the origin of Sry, therefore, seems to have involved the acquisition of a novel function (neomorph) and it could have been the primary drive for the separation of the two sex chromosomes. These authors are confused between the evolution of sex chromosomes and the evolution of modified sex-determining systems To understand why the sex chromosomes don’t recombine, we need to understand WHY interacting genes are involved, which requires understanding HOW separate sexes evolved, and what kinds of genes were involved BC, DC (1978, Amer. Nat. 112: ) : evolution of sex-determining region with two loci (driving selection for less recombination) This question is separate from: how is recombination lost? single step when the sex chromosomes orginated or a gradual process, with several successive steps, and whether inversions were involved?

How can one get sex-linked genes to map sex-determining chromosomes?
To estimate ages of sex chromosomes, and to study degeneration, we need to find genes and study alignable X and Y alleles There are few known mutant phenotypes (as Muller realised) Molecular methods are needed (Muller realised this too, in 1922) Even with “complete” genome sequences of important “model organisms” there are still great difficulties The gene content of the Y chromosomes of important “model organisms” have only recently been determined Drosophila: Carvalho et al PNAS 98: Humans: SKALETSKYet al., 2003 Nature 423: , BHOWMICK et al, 2007 Genome Res. 17: ; Chimpanzee: HUGHES et al Nature (13 January 2010). The mouse Y is still not well characterized and sex chromosomes of non-model organisms” are only now starting to be studied — EST sequences can be very helpful e.g. Dreyer et al ESTs and EST-linked polymorphisms for genetic mapping and phylogenetic reconstruction in the guppy, Poecilia reticulata. BMC GENOMICS 8:269, Tripathi et al Genetic linkage map of the guppy, Poecilia reticulata, and quantitative trait loci analysis of male size and colour variation. Proceedings of the Royal Society B 276, How can one get sex-linked genes to map sex-determining chromosomes?

Why is it difficult to sequence Y chromosomes?
Low gene density makes finding genes very difficult. Rearrangements: one homolog cannot used to help align the other, unlike the autosomes Y can be sequenced from a single individual Their intergenic regions and introns contain large amounts of repetitive sequence, so it is difficult to find the different parts of the same gene Assembly of highly repetitive genomes is very difficult it requires large sequenced regions, such as BAC clones, but these may be difficult to sequence if they contain repetitive sequences These are sometimes unstable when cloned, and so cannot be sequenced They may compete in PCR reactions, so that some copies fail to amplify If the repetitive sequences are AT-rich, poor strand separation may impede sequencing reactions In humans and Drosophila, Y-linked genes have been found, and, in humans, some have X-linked alleles

The human MSY region genes
Genes on Y only Genes on X and Y Heterochromatin Y genes with male functions can be kept on the Y because the sex chromosomes don’t recombine across much of their length. These genes are probably prevented from degenerating There are a few X-Y gene pairs (X homologous genes), even in the non-recombining regions (NRY) Many Human Y genes have male functions

Maybe one should sequence the genome?
Maybe one should sequence the genome? Overview of the Marchantia polymorpha YR2 region — so far in this species mainly Y chromosome data, not X and Y. This species is expected to have an old Y chromosome 50 Y-linked housekeeping genes are also found in females (presumably non-degenerated genes, with autosomal or X-linked copies) 14 Y-linked genes are unique to males, and expressed only in reproductive organs G = genes (indicated by arrows ) P = pseudogenes O= organelle sequence T = transposable element

The genus Silene Dioecious Dioecious (independent evolution) Hermaphrodite Gynodioecious I emphasized how helpful it is to identify genes, not just anonymous markers or sequences, and that plants are interesting for studying de novo evolution of sex chromosomes (because sex chromosomes have evolved recently in several taxa) BUT finding X and Y genes in non-model species is difficult, and the S. latifolia genome is big! Plants Estimated from ITS sequences by Desfeux, C., et al Proc. Roy. Soc. Lond. B. 263: Recent work with more nuclear genes supports these phylogenetic relationships Humans

How else can one find sex-linked loci?
Testing linkage of known genes involved in flower development, using families MROS3-X and -Y (Dave Guttman, 1998) SlAp3 (Sachi Matsunaga 2003) cDNA probing of micro-dissected Y chromosomes SlX/Y1 (Delichère et al. , 1999) SlX/Y4 (Atanassov et al., 2001) SlX/Y3 (Nicolas et al. 2005 Genes can now be discovered from cDNA libraries and EST sequences of any species of interest SlSs-X/Y Dmitry Filatov SlCyp-X/Y Roberta Bergero Isomerase, cyclophilin type Sl8-Y only Roberta Bergero Mono-oxygenase/haem binding protein Sl6a and b X/Y Roberta Bergero Unknown protein (2 Y and X copies) Sl7X/Y Roberta Bergero Unknown protein RB11 and RB18 Roberta and Vera Kaiser Differential display DD44 (Moore et al., 2003) It is interesting to combine sequence divergence estimates with genetic maps

X- and Y-linkage for locus Sl6
EST sequences were used to obtain sequences Intron positions of genes at low copy number were determined from the Arabidopsis thaliana and rice genomes PCR primers were designed to cross introns to find length variants to do genetics Parents F1 progeny Y-linked 1830 bp 730 bp maternal X 2072 bp 700 bp 590 bp paternal X 500 bp 510 bp maternal X 590 bp paternal X X- and Y-linkage for locus Sl6

Roberta’s ISVS method Forward primer Exon A Exon B Reverse primer
Intron region Exon A Exon B Reverse primer FAM Incorporation of labeled universal primer after the first PCR cycles FAM Analysis by capillary electrophoresis For product sizes > bp, digest with restriction enzyme FAM MboI HaeIII FAM MboI FAM MboI HaeIII

Evidence for X/Y linkage of the SlCyp gene
Intron 3 variants, showing Y-linkage of 438 bp band Intron 2 variants , showing X-linkage of 259 and 260 bp bands 2 male and 2 female F1 plants Parents 260Xm 257Y 260Xm 259Xp 259Xp 260Xm 257Y 438 bp in males only 447 bp 447 bp

3. WHEN did sex chromosome systems evolve, and when did recombination stop?
Some classical sex chromosomes are probably old We don’t yet know how long it takes for the full set of features to evolve It is often assumed that all other systems are young but we need data. It is now possible to get evidence, using DNA sequences, estimating divergence between homologous X and Y sequences, and assuming a molecular clock heteromorphism can evolve rapidly, e.g. by chromosome fusions For most species, it is difficult to get the genes for such studies

X-Y divergence in humans
2 genes transposed very recently to the Y Autosomal in marsupials (added to X and Y by transposition. Xp Xq (3) In contrast with Xq, many Xp genes still have detectable homologues on the Y X-Y divergence, Ks Stratum 1 Stratum 2 Stratum 3 PAR1 (1) Mostly old part of X (all but 2 genes present in marsupial X chromosomes) (2) Few genes on the X are still detectable on the Y recent transposition Strata 4 & 5 X-Y divergence in humans LAHN & PAGE, 1999 Four evolutionary strata on the human X chromosome. Science 286: SKALETSKY et al Nature 423:

Strata are found in organisms other than humans
(Z versus W) (X versus Y) Human (X versus Y) (X versus Y) NOTE the different y axis scale PAR1 PAR PAR transposition inversion Mostly old part of X (all but 2 genes present in marsupial X chromosomes) Autosomal in marsupials (added to X and Y by transposition) Lawson-Handley et al., 2004 Genetics 167: Nam & Ellegren Genetics 180: Bergero et al., 2007 Genetics 175:

from LAWSON-HANDLEY et al., 2004 Genetics 167: 367-376
Phylogenetic analysis of bird Z and W chromosomes also suggests that recombination between them stopped at different times Pseudo- autosomal end Chicken Z Genes that stopped recombining after split of taxa Genes in region where Z- W recombination stopped before split of major bird taxa Some bird taxa probably have small sex-determining regions from LAWSON-HANDLEY et al., 2004 Genetics 167:

Gradual evolution of bird sex chromosomes is also evident when different taxa are compared — some taxa have not undergone all the steps that others have taken Giemsa C-bands G-bands Painting with Locations of staining by BrdU chicken Z markers probe Markers: Ostrich Chicken Non-recombining region has probably remained small Large non-recombining region Z W Z chromosomes of both taxa share several markers Thus they probably had the same ancestral sex chromosome Recombination has been suppressed only in the chicken lineage (including other neognathae), and not in palaeognathous birds Nishida-Umehara et al Chromosome Research 15: Nanda, I et al Cytogenet Genome Res 122:

Gradual evolution of snake sex chromosomes Females are WZ
P. molurus (Pythonidae) Females are WZ E. quadrivirgata (Colubridae) Matsubara et al. (2006) PNAS 103: 18190 Many (11/11) genes shared between Z and W (small sex-determining region) 3/11 genes shared between Z and W No genes shared between Z and W (W has lost most genes) T. flavoviridis (Viperidae)

(Ks is uncorrected synonymous or silent site divergence)
Ks values in 6 X and Y Marchantia polymorpha genes suggest that this sex chromosome system is old (Ks is uncorrected synonymous or silent site divergence) Ks If we had a good molecular clock, we could translate Ks values into times when X-Y recombination stopped It is not yet possible to tell whether there are strata in this plant, or if the Y and/or X is degenerated

Ks values in 4 papaya genes from a BAC clone
Is papaya (with a small MSY) a young system? Divergence is low between papaya X and Y gene sequences Ks values in 4 papaya genes from a BAC clone X and Y from hermaphrodite (Yh, YU et al, 2007 Plant Journal 53: ) X and Y from male (YU et al, 2008 Tropical Plant Biology 1: 49-57) It is not yet possible to tell whether there are strata in this plant, because only 2 BACs were sequenced (< 150 kb, whereas the size of the MSY is ~ 10 Mb)

Summary of question 3 Some classical sex chromosomes are old
Even in such old sex chromosomes, recombination in most of the chromosome sometimes continued for long after the sex chromosome first evolved, and, in some species (but not all) later stopped in some regions in mammals, birds and Silene latifolia It is not yet clear whether species with small non-recombining regions of their sex-determining chromosomes are always young sex chromosomes Some of them could be sex-determining chromosomes with single gene control of gender, and therefore without selection for reducing recombination

WHY are there strata? Why doesn’t recombination just stop across the entire sex chromosome? The simplest 2 gene evolutionary model above suggested that sex determining loci must initially be linked for separate sexes to evolve 1 2 3 M SuFemale m f “proto-X” “proto-Y” Other genes may be added to the system in a 3rd step (and so on) M SuFemale M2 “proto-Y” Reduced recombination between initial 2 genes sexually antagonistic male-enhancer “Y”

There may be molecular ways to test for antagonistic genes
The hypothesis of sexually antagonistic male-enhancers is plausible, but all evidence to date is indirect, and the only such genes yet identified are in the guppy indeed many are wholly or partially sex-linked without sexual antagonism, there should be no selective pressure converting hermaphrodites into males (the female functions of hermaphrodites could be maintained unchanged while male functions improve). There may be molecular ways to test for antagonistic genes in chicken and mouse, Mank et al. (2008 American Naturalist 171:35-43) searched for genes with different male and female expression patterns many of these will NOT have antagonistic effects (they could just have sex-specific expression), but the set of such genes should include genes with antagonistic effects They found that this set of are less likely to be expressed in multiple tissues (with the potential for conflicting selection pressures) than the genome average, even after excluding sex-linked genes; however, a difference in tissue-specificity could be explained without sexually antagonistic effects

Fertility of male parents
Drosophila experiments that allowed selection in males only show that female fitness indeed declines This is consistent with a trade-off between the sex functions, but it could be due just to stopping selection in females Reversal in quality of progeny, depending on whether they had high or low fertility parents, is clear evidence for trade-offs, but it does not prove intra-locus sexual conflict Fertility of female offspring Fertility of male offspring High fertility female parents Low High Fertility of male parents Low fertility female parents Pischedda & Chippindale (2006, PLoS Biology 4:e356)

The best evidence so far for sexually antagonistic male-enhancers is in the guppy fish, Poecilia reticulata Guppy males are highly polymorphic for color patterns and their genetics has been studied analysis since 1927 This fish has 23 pairs of chromosomes — 22 autosomal and one sex-determining. Males are heterogametic (the sex determination mechanism is “XX/XY”, and the “YY” genotype is viable) Almost all the genes determining guppy colour patterns (except for body color) are fully or partially sex-linked or sex limited (unlike what is found in other teleosts) Winge, O The location of eighteen genes in Lebistes reticulatus. Journal of Genetics 18,. A peculiar mode of inheritance and its cytological explanation. Journal of Genetics 12:137. With the possibility of using naturally occurring polymorphic sequence variants as genetic markers, it is now possible to make a more detailed genetic linkage map and find out if the Y has an excess of male attractiveness factors Molecular markers have now been found on the Y chromosome, closely (but none fully) linked to the sex-determining region. Shen et al (2007, Aquaculture 271: ), TRIPATHI et al. (2009, Proc. Royal Society B 276: ) Overall, the results suggest that the non-recombining MSY region may not be very large, and that the colour variants may be controlled by polymorphic genes in the PAR

4. HOW did recombination stop, how do MSY regions expand?
‘..there is little evidence demonstrating the importance of [chromosome rearrangements versus genes modifying recombination] in the evolution of X-Y crossover suppression’ (Bull 1983) There are many inversions on the mammalian Y BUT the known inversions on the Y occurred relatively recently, and these cannot be involved in stopping recombination (since, in most of the Y, it stopped long ago) SRY/ SOX3 Translocation Lahn & Page’s suggested evolutionary history of the mammalian sex-chromosomes

NRY regions Mammalian X chromosome gene arrangements are stable, while Y chromosomes are highly rearranged BUT inversions occurred since humans split from chimpanzees and modifier genes can also change recombination rates during evolution recently transposed from the X PAR1 (or PSA) Yp degenerated copies of X genes “Ampliconic” (duplications) X chromosomes Human degenerated X genes inverted Heterochromatic region PSA2 Yq inverted Chimpanzee

The papaya MSY (male-specific non-recombining) regions have been rearranged, even in just the two BACs so far studied It is not known whether this region contains the sex-determining genes, or whether these inversions caused recombination to stop, but this region is only a small part of the MSY The rearrangement in this region is shared by the Y and Yh, and differentiates both of them from the X Thus it either dates from, or pre-dates, the evolution of hermaphrodites, suggesting that several events suppressing recombination have occurred X from hermaphrodite Y from hermaphrodite (Yh) 6.5 Mb Y from male Y from hermaphrodite (Yh) 6.5 Mb X from male X from hermaphrodite X-Y divergence (%) Yu et al Tropical Plant Biology 1: 49-57

The most recent strata in the human MSY already have several inversions
Stratum 5 may involve an inversion, but stratum 4 includes several inversions ( ) Rearrangements may thus occur as a consequence of lack of recombination, as well as causing recombination to cease (Lemaitre et al Footprints of Inversions at Present and Past Pseudoautosomal Boundaries in Human Sex Chromosomes. Gen Biol Evol. 1, ) Stratum 5 Stratum 4 Stratum 3 PAR1 Ross et al Nature 434:

5. Where are the sex-determining genes? Did X-Y recombination stop in S. latifolia due to inversions? Y chromosome deletion map of the Y, based on 3 parental plants A C B In one parent plant, the Y chromosomes gene SlY1 is in a different location In two parent plants the Y chromosomes gene SlY6b is absent

Possible rearrangements in the Y, relative to the X
Pseudo-autosomal Present X gene order Alternative Y gene order Proto-Y1 Present Y p arm RB11 (no Y copy) RB18X M M m RB18Y Suf SuFemale SuFemale q arm Paracentric inversion Pericentric inversion These results show that inversions happened after X-Y recombination first stopped in the region containing genes SlXY3, 4, 7 and 6a

X Y X Y Accumulation of transposable element
on Y chromosomes may promote rearrangements Loss of a gene in primates: Nakayama & Ishida Genome Res. 16: Rearrangements can obscure X-Y heteromorphism Gene conversion between paralogs in the human Y: Bosch et al Genome Res. 14: Cytogenetic maps of the threespine stickleback X and Y chromosomes, based on FISH with genes X Y inversion X Y Heteromorphic X-Y pair X Y deletion of part of Y deletion inversion on Y and/or insertion, making heteromorphism hard to detect Ross and Peichel. Genetics 2008;179:

6. Why does stopping recombination lead to sex chromosome degeneration, and how fast is it?
It has been known since 1918 that classical Y chromosomes are degenerated chromosomes Muller, H. J Genetic variability, twin hybrids and constant hybrids, in a case of balanced lethal factors. Genetics 3: “It is probably needless to point out that the W and especially the Y chromosome ….. show the expected evidences of …. degeneration and differentiation from their homologues, both genetically and cytologically. The evidences are now as follows: X-linked mutations affecting visible phenotypes are manifested in XY males therefore the Y does not carry alleles that can cover up mutations Infrequent dominant Y (and W) linked mutations” “Great variations in their own size and shape even in closely related species” Synaptic attraction between them and their homologues “but the sex chromosomes in the heterozygous sex tend to remain condensed during the growth period, while the autosomes are spinning out for intimate conjugation, and there is frequently delayed synapsis” “also lack of crossing over between them and their homologues, even …. where other chromosomes are undergoing crossing over”

Y chromosome degeneration
Loss of genes Well illustrated by classical sex chromosomes for example, the human X region that has been non-recombining longest has the lowest proportion of intact genes on the Y (at most, 5), whereas the probable number carried on the X chromosome is 734 (based on a count done by Gabriel Marais, using Ensembl version 47) Worse gene function amino acid substitutions that reduce functioning less use of optimal codons expression levels changed relative to X (presumably wrong levels) Transposable element insertion is often included as an aspect of Y degeneration, and degeneration may indeed be caused partly by transposable element insertions, but we don’t actually know this it is possible that these insertions are neutral they could insert after genes or the sequences controlling their expression have degenerated

NOTE that most of the genes present on the human Y are found in the youngest stratum of the X (strata 3 and 4 in the initial paper on strata) This indicates that the older strata are genetically degenerated and have lost most of the genes that were once on the Y Notice how helpful it is to have identified genes, not just anonymous markers or sequences LAHN & PAGE, 1999 Four evolutionary strata on the human X chromosome. Science 286:

Work of Michael Nicolas and Roberta Bergero
Gene CypX/Y DD44 Pyrosequencing Leaf Flower X/Y4 X/Y7 X/Y3 X/Y1 Little is known about degeneration in plants. Expression studies in S. latifolia give some direct evidence of low Y function Differences between X and Y homologues, estimated using PCR with primers recognising the same sequence in X and Y alleles G C T A T C A SlCypY AATTTGCACACCAACAAAGCATCACG SlCypX AATTTGCACACCAACAAAGTATCACG pyrosequencing primer Work of Michael Nicolas and Roberta Bergero

6. WHY are Y chromosomes degenerated. I
6. WHY are Y chromosomes degenerated? I. The ‘sheltering hypothesis’ (the Y is always heterozygous with an X) It is a challenge to evolutionary biologists that a common observation such as degenerate Y chromosomes is still so far from being understood’ (Bull 1983, p. 258) “The reason for this rapid decay of things Y-chromosomal is thought to be quite simple: once the Y chromosome became sex-determining, its presence was limited to the heterogametic sex (in our case, males). Because the Y chromosome was never found in the absence of an X chromosome, there was presumably little selection against the mutational inactivation of those genes on the Y chromosome that were also present on the X chromosome. Thus, over evolutionary time,the Y chromosome gradually lost most of its functional genes by the accumulation of deleterious mutations, resulting in that little dab of male-determining chromatin that we have today.” HAWLEY, R., 2003 The human Y chromosome: Rumors of its death have been greatly exaggerated. Cell 113: This is wrong — it ignores the central importance of the lack of recombination

Models of non-recombining genomes have largely answered Bull’s challenge
There are now several other theories for degeneration when there is no recombination

Selection for advantageous mutations causes fixation of deleterious mutations , which reduces the effective population size Many different sequences, one Only a single sequence, i.e. all carrying the deleterious mutation carry the deleterious mutation several generations Deleterious mutations prevent spread of advantageous mutations unless their selective advantage is large several generations

Muller’s ratchet (probably less important)
4 1 8 7 2 3 5 6 9 After many generations with stable numbers of deleterious mutations Ancestral genotype number Genotype number 10 different sequences 4 ancestral sequences Selection against mutations reduces the effective size Loss of mutant-free class

Summary of question 6: WHY are Y chromosomes degenerated?
Hitch-hiking processes in non-recombining regions lower the effectiveness of natural selection There are several molecular evolutionary approaches that allow us to detect this I will next describe transposable element accumulation and some sequence analyses

Autosomes neo-Y chromosome
A sign of low effectiveness of selection is accumulation of repetitive DNA on Y chromosomes Autosomes Accumulation of retrotransposons on the Drosophila miranda neo-Y chromosome neo-Y chromosome BACHTROG, D., Mol. Biol. Evol. 20:

Transposable elements
Drosophila miranda The neo-Y is turning into heterochromatin Transposable elements Genes

TE insertions do NOT necessarily cause loss of function Two Silene latifolia Y genes
DD44 Y S. latifolia X Work of Gabriel Marais Blastn Y3 / Y3 Blastn Genbank RepeatMasker (Repbase) Blastx prot TEs Arabidopsis S. vulgaris (not sex-linked) SlXY3 Y X Introns LTR retrotransposon Non-LTR retrotransposon Exons Inverted repeats DNA transposon Direct repeats

Active MITE insertions were detected by searching for polymorphic inserts in introns of Silene latifolia genes EITRI: 11-bp terminal inverted repeats (5'-CTAGGTAGCAC-3') and 8-bp target site duplications (TSDs, like hAT or P elemenst) A Tourist-like element M GAAATTCTTT//Sl-To1//TAGTTTC GAAATT TAGTTTC GAACTTCTTC AGTTTC Roberta Bergero & DC, in press in Genetics

Silene latifolia Not Y-linked (none fixed)
Genetic mapping allows us to find ones that are Y-linked As predicted from population genetics theory, MITE insertions are generally at low frequencies, but on the Y chromosome they reach high frequencies, perhaps in part because there are few genes Y-linked (3/25 fixed, others at high frequencies)

Data from non-degenerated genes can provide indirect evidence that degeneration is occurring
Degeneration is thought to be caused by lack of recombination This changes evolutionary processes in several ways The different processes all cause lower “effective population size” and thus they lead to low genetic variation Diversity studies can thus detect these processes If degeneration is happening, we should find lower diversity of Y-linked than X-linked genes We must take into account that the population size of X-linked genes is 3 time higher than for Y-linked genes

Y-linked X-linked or autosomal
To estimate subdivision for Y and X genes within S. latifolia, we sampled plants from 23 European populations, and sequenced Y and X alleles X-linked or autosomal Y-linked Nucleotide diversity values (silent sites) S. latifolia Y diversity is low compared with homologous X-linked genes significant difference in diversity compared with the autosomal genes (by an HKA test) Diversity of autosomal and X-linked genes is very variable, and can be very high No significant difference by an HKA test

What do we expect for the S. latifolia Y chromosome?
X chromosome = 1/7 of genome Assume that the S. latifolia genome contains 21,000 genes (a conservative estimate for a plant), we get ~ 3,000 genes for the Y if it has lost no genes, or perhaps 2,000 is the PAR has 1/3 of the genes (it probably has many fewer than this), i.e. 25 times more than the dot chromosome This predicts a much greater reduction in diversity that the estimated value, and therefore suggests that the Y may have lost many genes D. melanogaster 4th (dot) chromosome (80 genes) Predicted with moderately deleterious mutations Predicted with moderately and slightly deleterious mutations and no recombination Diversity relative to the neutral value 1.0 0.1 0.01 0.001 0.0001

Molecular evolutionary comparisons of X, Y and outgroup sequences allows one to test whether the X or Y has changed, again using non-degenerated genes Outgroup species X chromosome Y chromosome G A A Numbers of changes on branches This is OK if the number of changes is small, I.e. the species are closely related Lower left black branch 3 Upper right grey branch 3 Upper left striped branch 0 A G substitution Ancestral sequence

Inferring the causes of degeneration One can infer maladaptation from divergence
If the neo-Y genes are acquiring harmful mutations that impair their functionality, we expect to find more changes in functionally significant sequences in the ancestry of the neo-Y copies than the neo-X copies (e.g. more non-synonymous substitutions). Y X outgroup species The opposite is true if the neo-X genes experience adapt more than the neo-Y We can test this by sequence comparisons X-Y or along the 2 lineages

The neo-sex chromosomes in D. miranda
are a model system for studying sequence divergence across many genes A consistent pattern of higher Ka than Ks for Y than X sequence divergence across many genes in D. miranda is difficult to explain by molecular adaptation of the Y (it would be very strange if all Y genes were adapting) Bachtrog, D Genome Research 15:

Similar results have been found in birds
Chicken Z Turkey Z Chicken W Turkey W The W chromosome (restricted to females) has relatively more non-synonymous substitutions (higher Ka/Ks) than the Z (but a caveat is that the outgroup is ~VERY distant) Berlin & Ellegren Journal of Molecular Evolution 62:66-72

In Silene latifolia genes, Gabriel Marais sees both failure of selection to prevent deleterious substitutions, and favorable changes switching to neutral Gene (Numbers of codons analyzed) Site model indicates purifying selection at all loci Branch model X versus Y dN/dSX dN/dSY Significance Branch-site analysis suggests weak efficacy of selection on Y % of codons suggesting degeneration, and changes in Y versus X and outgroup (to neutral evolution or positive selection) SlX1/Y1 (458) 100%  <<1 10-4 0.11 X < Y*** 6% No significant switching SlCypX/Y (519) 94%  <<1 6% w~1 0.14 X = Y 10% SlssX/Y (259) 97%  <<1 3%  >1 0.18 0.23 X < Y ns DD44X/Y (217) 63%  <<1 36%  ~1, 1%  > 1 0.13 0.90 dNX=dNY=dSY (all low values) 5.5% under positive selection (=14.8) Significant switching to positive selection SlX3/Y3 (318) 95%  <<1 5%  ~1 0.04 X < Y* 4% under positive selection ( =3.5) SlX7/Y7 (246) 88%  <<1 12%  ~1 0.08 4% SlX4/Y4 (362) 92%  <<1 6%  ~ 1, 2%  > 1 0.25 14% Significant switching to neutrality We just counted the number of sites corresponding to different cases. … and we found that the situation was quite diverse in both genes. but for gene 3 the majority of switches are from 1,3 to 2 and concern Y sequences, showing that Y copies of these genes evolve faster because they are degenerating. for gene 4 the majority of switches concern Y sequences again, but are from 1,2 to 3, showing that Y copies of this gene evolve faster because of positive selection. Significance of differences in LR tests: ns = non-significant, * p < 0.05, *** p <

Human-chimpanzee divergence
Autosomes Number of 1 MB windows Over all sites, genes on the mammalian X evolve more slowly than autosomal genes (indicating selective constraints, which are more important on the X because of hemizygosity in males) and the Y evolves unusually fast (because there is a higher mutation rate in males, due to multiple cell divisions in spermatogenesis) X Human-chimpanzee divergence Y Human-chimpanzee divergence The Chimpanzee Sequencing and Analysis Consortium 2005 Nature 437: X

The PAR recombines at a much higher frequency than the rest of the X, increasingly so as its size is restricted by evolution of new strata High recombination may also cause a high mutation rate (if recombination causes mutations) The PSA is smaller in humans than other mammals, i.e. the boundary has moved towards the tip, compare with its location in bovine X chromosomes (A) Graphical representation of unique BLAST hits (E-value < 10−2) between the human and bovine X chromosomes. Sequences mapping to human PAR1-2 or strata 1–5 are color-labeled as indicated. (B) Schematic representation of distal Xp in human indicating the limits between strata III, IV, and V (green) and PAR1 (red), and approximate positions of 10 genes. Known pseudoautosomal (P), X- specific (X), or autosomal (A) status of orthologs in six mammals with corresponding references. and in mice it is small due to movement of genes off the X Van Laere A. et.al. Genome Res. 2008;18:

Summary of steps in the evolution of the Y
Proto-X and Y Male sterility, m Female fertility Maleness factor, M Female suppressor, SuF Summary of steps in the evolution of the Y Addition of male function genes, further recombination suppression, rearrangements small MSY region Loss of parts of Y 1 M2 MSY SuF m M M2 Evolution of a sex-determining region in an ancestral chromosome pair, forming a non-heteromorphic pair Newest stratum SuF Suppressed recombination on part of proto-Y M Oldest stratum 2 Transposable element accumulation and expanded MSY region PAR Y X Classical (humans and Drosophila) The simplest evolutionary model suggests that males and females evolved from hermaphrodites by loss of functions Some plants, fish, snakes 3 4 5

Adaptations during sex chromosome evolution
(1) In species with XY systems The Y chromosome may acquire genes with male functions Genes with male functions may also evolve more readily on the X than the autosomes, because the X spends a higher proportion of its evolutionary history in males than females VICOSO & CHARLESWORTH, 2006 Evolution on the X chromosome: unusual patterns and processes. Nature Reviews Genetics 7: ; POTRZEBOWSKI et al The emergence of new genes on the young therian X. Trends in Genetics 26: 1-4.

(2) If degeneration has occurred, then, at most X-linked loci XY males have only one gene copy, compared with XX females’ two copies except for a few housekeeping genes on both X and Y Some species have evolved control of levels of expression so that levels of X-linked gene products are correct, relative to expression of other genes: dosage compensation The X must therefore undergo considerable evolutionary change The compensation mechanisms are different in different organisms These changes must involve sexually antagonistic effects The simplest solution is over-expression of the X in males, as in Drosophila low expression of both Xs 2X 2A X 2A 2X 2A X 2A 2X 2A XO 2A Females Males Females Males “Females” Males Drosophila C. elegans Mammals inactivation of one X

7. What about other non-recombining systems?
WHY did recombination stop, and what are the consequences, e.g. do these genome regions degenerate? Some fungal incompatibility systems Different loci (pheromones and receptors) are involved at some of these “loci”, and are sometimes present in inverted regions, but the selective reason for lack of recombination is unknown Lee et al The mating-type and pathogenicity locus of the fungus Ustilago hordei spans a 500-kb region. PNAS 96: Some seem to have undergone degeneration. Allelic forms of the genome region each lack genes found in the other orthologous region TEs are sometimes abundant (50% in U. hordei, maybe accumulated, but comparisons with other genome regions should be made) Bakkeren et al Fungal Genetics and Biology 43: Angiosperm self-incompatibility systems (SI, S-allele systems) Alleles at two different loci (encoding pollen and pistil function proteins) must be present in the correct combinations, which would lead to selection against recombination, but it is not yet certain whether these regions do have unusually low recombination Studies testing whether homozygotes for the same allelic form at these “loci” are disfavoured (suggesting “linked load”) are not yet conclusive

Short -styled Long-styled
Distyly Primrose Primrose Short -styled Long-styled The different flower characters are controlled by at east 3 closely linked genes This is called a ‘supergene” Style length Anther position Pollen compatibility type Buckwheat

BUT it is difficult to test more than a few alleles
Even if the S-locus region has low recombination, it may be too small (contain too few genes to drive the processes described earlier) to undergo genetic degeneration The possibilities were reviewed by Uyenoyama, M. K Evolution under tight linkage to mating type. New Phytologist 165: Some empirical tests have suggested that individuals identical by descent for S alleles may have low survival BUT it is difficult to test more than a few alleles one has to compare homozygotes and heterozygotes, matching their inbreeding coefficients, I.e. ensuring that both sets are non-inbred (otherwise inbreeding depression might be the cause of lower survival of homozygotes) it is also hard to rule out an early effect of the incompatibility (which might slow the growth of the pollen that would generate homozygotes, and might lead the maternal plant to abort those zygotes)

This region has expanded
Fungal and algal mating type loci are NOT sex chromosomes, but they show some very similar evolutionary behaviour In Neurospora tetrasperma, there is a non-recombining region whose function is to link the incompatibility gene region to the centromere, guaranteeing first division segregation and thus compatibility among pairs of meiotic products (a mechanism for self-fertilisation) This region has expanded Divergence between genes in the two haplotypes varies in a pattern like the sex chromosome strata Menkis et al The mating-type chromosome in the filamentous ascomycete Neurospora tetrasperma represents a model for early evolution of sex chromosomes. PLoS Genetics 4 The expansion is due to an inversion and the effects of modifier genes Jacobson Blocked recombination along the mating-type chromosomes of Neurospora tetrasperma involves both structural heterozygosity and autosomal genes. Genetics 171: The mating-type loci of Cryptococcus and Microbotryum fungi (also self-fertilising) may be similar FRASER et al., 2004 PLoS Biology 2: , Votintseva & Filatov, 2009 Genetics May 2009.

This is like a neo-sex chromosome system — a part was added recently
NOTE: incorrect use of the word ‘rate’ (they mean ‘divergence’)

The evolution of sex chromosomes: similarities and differences between plants and animals Deborah Charlesworth Institute of Evolutionary Biology, University.

Similar presentations

Presentation on theme: "The evolution of sex chromosomes: similarities and differences between plants and animals Deborah Charlesworth Institute of Evolutionary Biology, University."— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

The evolution of sex chromosomes: similarities and differences between plants and animals Deborah Charlesworth Institute of Evolutionary Biology, University.

Similar presentations

Presentation on theme: "The evolution of sex chromosomes: similarities and differences between plants and animals Deborah Charlesworth Institute of Evolutionary Biology, University."— Presentation transcript:

Similar presentations

About project

Feedback