1. Tool used to create a DNA fingerprint
Flashcard Warm-up
Restriction enzymes
Enzymes that will cut DNA at specific places. This can be used to create DNA fingerprints or to insert genes through gene therapy.
My picture:
My definition:
Gel Electrophoresis
Tool used to create a DNA fingerprint

2. Unit 9 Biotechnology and Genomics
This is NOT a DNA fingerprint.
This is a DNA fingerprint.

3. DNA Fingerprint A unique band pattern of DNA fragments.
Unique to every individual, unless you have an identical twin

4. DNA Fingerprint Gel Electrophoresis:
a tool used to create a DNA fingerprint; separates pieces of DNA based on size
(the number of base pairs in each piece).

5. DNA Fingerprint Steps in DNA Fingerprinting
Step 1: Restriction enzyme cleaves specific DNA sequence
Restriction enzyme: the enzymes that “cuts” the DNA between the nitrogen bases
Cleave: to Cut

6. DNA Fingerprinting Step 2: DNA loaded into a gel electrophoresis..
Step 3: Bands are created as electricity forces DNA fragments through the gel. Small pieces move further than larger pieces.

7. Running a gel 1 2 3 fragments of DNA separate out based on size
cut DNA with restriction enzymes 1 2 3
Stain DNA
ethidium bromide binds to DNA
fluoresces under UV light

8. DNA Fingerprint Uses for DNA Fingerprinting:
Violent Crimes – determines source of DNA left at a crime scene.
Paternity - used to determine the father of a child

9. Uses: Evolutionary relationships
Comparing DNA samples from different organisms to measure evolutionary relationships
turtle
snake
rat
squirrel
fruitfly – 1 3 2 4 5 1 2 3 4 5
DNA  +

10. Example
A DNA sample was retrieved from a rape kit completed at the hospital. The police have 3 possible suspects. A DNA fingerprint has been done to narrow done the suspect pool. Who is the police’s MAIN Suspect?

11. Ticket out the Door
1. Why are restriction enzymes important when making a DNA fingerprint? 2. What do the bands represent on a DNA fingerprint? 3. Using the fingerprint to the right who is a possible suspect for murder?

12. Flashcard Warm-up Recombinant DNA/ Genetic Engineering
Technology that combines DNA from two different organisms. One practical application of this process is making human insulin for people with Diabetes.
Glo fish were the first genetically engineered
Pet in 1993!
A gene called “green fluorescent protein” was extracted from jellyfish to create the first glo fish. Their goal was to develop a fish that could detect pollution by selectively fluorescing in the presence of environmental toxins

13. Is the male in the fingerprint the father of the girl?

14. Can we mix genes from one creature to another?
YES!

15. We have been manipulating DNA for generations!
Artificial breeding or AKA artificial selection
creating new breeds of animals & new crop plants to improve our food
A process in which humans consciously select for or against particular features in organisms. For example, the human may allow only organisms with the desired feature to reproduce or may provide more resources to the organisms with the desired feature

16. Evolution of modern corn (right) from ancestral teosinte (left).
Breeding food plants
Evolution of modern corn (right) from ancestral teosinte (left).

17. Most practical application of GENETIC ENGINEERING…
Creating Insulin (a protein hormone) for people with Diabetes

18. Genetic Engineering
Genetic Engineering: Modifications of DNA; AKA Recombinant DNA
Transgenic Organism: an organism which contains foreign DNA
A gene isolated from a species of jellyfish which causes fluorescence was introduced into marmoset embryos that allows them to build green fluorescent protein (GFP) in their tissues. Which glows green when exposed to blue light.

19. Genetic Engineering Process in creating Transgenic organism:
Step 1: Restriction enzymes cleave DNA sequence at desired gene (ex. Insulin

20. Genetic Engineering
Step 2 : The same restriction enzyme is used to cleave the vector
Vector: The structure used to carry the foreign DNA bacterial plasmids commonly used.
Plasmid: Circular DNA found in bacteria

21. Genetic Engineering Step 3: Foreign DNA and Vector spliced together
Splice: Combine

22. Genetic Engineering
Step 4: The recombinant DNA is inserted into the host (bacteria cell). Host cell will copy and produce the protein

23. Genetic Engineering
Recombinant DNA: form of artificial DNA that is created by combining two different sources of DNA

24. Grow bacteria…make more
transformed bacteria
gene from other organism +
recombinant plasmid
vector
plasmid
grow bacteria
harvest (purify) protein

25. Why mix genes together?
How can bacteria read human DNA?
Gene produces protein in different organism or different individual
human insulin gene in bacteria
TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC aa
“new” protein from organism
ex: human insulin from bacteria
bacteria
human insulin

26. Bioethical Concerns for Genetic Engineering
Should we produce artificial proteins?
Allergic reactions (adding a peanut gene to a corn plant)
Environmental problems from creating transgenic organisms
(ex. Oil digesting bacteria)

27. GMO’s –What are they? GMO stands for Genetically Modified Organisms

28. Before GMO’s cross-breeding was the answer

29. Flashcard Warm-up Steps in genetic Engineering/ Recombinant DNA
transformed bacteria
gene from other organism +
recombinant plasmid
vector
plasmid
grow bacteria
harvest (purify) protein

30. Gene Therapy
Defective genes are identified and replaced with a functioning gene from another individual
Uses: replace missing of defective genes,
Ex. Treating cystic fibrosis and hemophilia

31. Human Genome Project
The Human Genome Project: is a collaborative effort among scientists from around the world to map the genes of a human.
Uses: determine whether individuals may carry genes for genetic conditions in the hopes to develop gene therapy or genetically based medicines

32. Ticket out the Door Foreign DNA is spliced into what type of organism?
What is a most common use of Recombinant DNA?
Tobacco plant displays a bioluminescence (glows) due to a protein found in fireflies which controls the fireflies luminescence. Which is the transgenic organism, Tobacco plant or the firefly?
What was the purpose of the Human Genome Project?

33. Recombinant DNA Ticket IN the door.
1. Place the lettered steps in the correct order.
2. What organism usually acts as the host cell in the process of genetic engineering?
3. What is a plasmid?
4. What do hydrogen bonds hold together in a DNA molecule?
A. Foreign DNA and Vector spliced together
B. The recombinant DNA is inserted into the host (bacteria cell).
C. Restriction enzymes cleave DNA sequence at desired gene (ex. Insulin
D. The same restriction enzyme is used to cleave the vector