Origin of Man and the Races

Origin of Man and the Races
Richard Deem, M.S. Reasons To Believe This lecture will examine the scientific and biblical data regarding the origin of modern humans and the human races. The object of this presentation is to examine the biblical and evolutionary models and determine which one fits the data better. This slideshow was presented as a two hour lecture at the King's College and Seminary November 8, 2002 and at Long Beach Christian Fellowship on February 28, The PowerPoint presentation (5 MB) is available for download at

General Outline Biblical data and scientific data Origin of man
mtDNA Mitochondrial DNA – A small piece of DNA that codes for a small number of proteins within the energy-producing sub-cellular organelle known as the mitochondrion Biblical data and scientific data Origin of man Molecular and genetic data – mtDNA and Y chromosome Neandertals and humans Bipedal primates and chimpanzees Origin of the races Listed above are the major categories of discussion for this lecture. Definitions DNA (Deoxyribonucleic acid) is the long molecule that codes for the information required to produce a living organism. DNA exists in the form of a linear polymer of nucleotides (adenine, guanine, thymine, or cytosine bound to a phosphorylated sugar - deoxyribose). Under normal circumstances, two strands of DNA are twisted together into the double helix. In eukaryotes (organisms whose cells contain a nucleus) DNA is packaged into chromosomes. mtDNA (Mitochondrial DNA) A small piece of DNA that codes for a small number of proteins within the energy-producing sub-cellular organelle known as the mitochondrion. Neandertal A species of hominid (Homo neandertalensis) that lived 150,000-30,000 years ago. Formerly known as Neanderthals. Bipedal The ability to walk upright on two legs.

Why All the Biology? And to the Jews I became as a Jew, that I might win Jews; to those who are under the Law, as under the Law, though not being myself under the Law, that I might win those who are under the Law; to those who are without law, as without law, though not being without the law of God but under the law of Christ, that I might win those who are without law. To the weak I became weak, that I might win the weak; I have become all things to all men, that I may by all means save some. (1 Corinthians 9:20-22) Since this lecture was presented to Christians, some would wonder why they had to learn a whole lot of biology to proclaim the message of Christianity. The apostle Paul, although he was an ultimate Jew (a Pharisee, the ruling Jewish class), preached primarily to Gentiles. However, he used different techniques to reach different groups of people. If Paul were alive today, I am convinced he would use the sciences to proclaim the Christian message.

Origin of Man Classic Hypothesis
European Humans African Asian Neandertals H. antecessor The classic evolutionary hypothesis, which is no longer considered to be valid by scientists, stated that a series of Homo species (Homo ergaster and Homo antecessor) evolved into Neandertals (Homo neandertalensis, formerly Homo sapiens neandertalensis), which gave rise to modern humans (Homo sapiens). Throughout this presentation we will be examining the current evolutionary hypotheses to determine how well they fit the current scientific data. H. ergaster

Origins of Mammals Soulish (nephesh) creatures created on days 5 and 6
The Hebrew word most often translated “soul,” referring to both man and animals, including mind, will, and emotion Creation of specific mammals (cattle, rodents, and carnivores) described for day 6. Though not specifically mentioned, probably included the creation of bipedal primates The biblical data from the book of Genesis describes the creation of the nephesh (soulish) creatures on the fifth and sixth days of creation (see Day-Age Genesis One Interpretation). Examples given include the "sea monsters" (i.e., whales), cattle, "creeping things" (i.e., rodents), and "beasts of the earth (i.e., carnivores).1 The bipedal primates, though not specifically mentioned, would have been created at this time also. Definitions nephesh The Hebrew word most often translated “soul,” referring to both man and animals, including those beings that exhibit mind, will, and emotion. Brown-Driver-Briggs' Hebrew Definitions: nephesh (Strong's H5315) soul, self, life, creature, person, appetite, mind, living being, desire, emotion, passion that which breathes, the breathing substance or being, soul, the inner being of man living being living being (with life in the blood) the man himself, self, person or individual seat of the appetites seat of emotions and passions activity of mind dubious activity of the will activity of the character Part of Speech: noun feminine A Related Word by BDB/Strong’s Number: from H5314 Same Word by TWOT Number: 1395a References Genesis: 1:20 Then God said, "Let the waters teem with swarms of living creatures [nephesh], and let birds fly above the earth in the open expanse of the heavens." 1:21 And God created the great sea monsters, and every living creature [nephesh] that moves, with which the waters swarmed after their kind, and every winged bird after its kind; and God saw that it was good. 1:22 And God blessed them, saying, "Be fruitful and multiply, and fill the waters in the seas, and let birds multiply on the earth." 1:23 And there was evening and there was morning, a fifth day. 1:24 Then God said, "Let the earth bring forth living creatures [nephesh] after their kind: cattle and creeping things and beasts of the earth after their kind"; and it was so. 1:25 And God made the beasts of the earth after their kind, and the cattle after their kind, and everything that creeps on the ground after its kind; and God saw that it was good. 1:26 Then God said, "Let Us make man in Our image, according to Our likeness; and let them rule over the fish of the sea and over the birds of the sky and over the cattle and over all the earth, and over every creeping thing that creeps on the earth." 1:27 And God created man in His own image, in the image of God He created him; male and female He created them.

Origin of Man – Biblical Data
Genesis 1:26 Then God said, “Let us make (asah) man in our image, in our likeness… The origin of man is described several times in the book of Genesis. Several different Hebrew verbs are used to describe the creation of man. The first description uses the Hebrew verb asah, which is most often translated "to make" or "to produce." The word tend to imply the creation of something from pre-existing materials. Definitions asah The Hebrew word most often translated “to make,” referring to the act of making something from pre-existing material. Brown-Driver-Briggs' Hebrew Definitions: asah (Strong's H6213) to do, fashion, accomplish, make (Qal) to do, work, make, produce to do to work to deal (with) to act, act with effect, effect to make to produce to prepare to make (an offering) to attend to, put in order to observe, celebrate to acquire (property) to appoint, ordain, institute to bring about to use to spend, pass (Niphal) to be done to be made to be produced to be offered to be observed to be used (Pual) to be made (Piel) to press, squeeze Part of Speech: verb A Related Word by BDB/Strong’s Number: a primitive root Same Word by TWOT Number: 1708, 1709

Genesis 1:27 So God created (bara) man in his own image, in the image of God he created (bara) him: male and female he created (bara) them. The second description of the creation of man uses the Hebrew word bara, which is most often translated "to create." It nearly always refers to acts done by God and usually refers to the creation of something brand new. Definitions bara The Hebrew word most often translated “to create,” referring to God's creative acts of something brand new. Brown-Driver-Briggs' Hebrew Definitions: bara (Strong's H1254) to create, shape, form (Qal) to shape, fashion, create (always with God as subject) of heaven and earth of individual man of new conditions and circumstances of transformations (Niphal) to be created of birth of something new of miracles (Piel) to cut down to cut out to be fat (Hiphil) to make yourselves fat Part of Speech: verb A Related Word by BDB/Strong’s Number: a primitive root Same Word by TWOT Number: 278

Genesis 2:7 Then the LORD God formed (yatsar) man of dust from the ground, and breathed into his nostrils the breath of life; and man became a living being. (Genesis 2:7) The third description of the creation of man uses the Hebrew word yatsar, which is most often translated "to form" or "to fashion." Like the word asah, it usually refers to the formation of something from pre-existing materials. Definitions yatsar The Hebrew word most often translated “to form,” referring to the act of making something from pre-existing material. Brown-Driver-Briggs' Hebrew Definitions: yatsar (Strong's H3335) to form, fashion, frame (Qal) to form, fashion of human activity of divine activity of creation of original creation of individuals at conception of Israel as a people to frame, pre-ordain, plan (figuratively of divine) purpose of a situation) (Niphal) to be formed, be created (Pual) to be predetermined, be pre-ordained (Hophal) to be formed (Niphal) to be created Part of Speech: verb A Related Word by BDB/Strong’s Number: probably identical with H3334 (through the squeezing into shape), ([compare H3331]) Same Word by TWOT Number: 898

Man – Part New, Part Old Bara – created new, probably refers to the spiritual qualities, self-awareness, moral understanding Asa, yatsar – made or formed from pre-existing material, probably refers to body and soul he descriptions from Genesis indicate that man is both a new creation and at least partially based upon a previous design. Genesis 2:7 indicates that man was formed from the "dust of the ground" - indicating creation was based upon pre-existing material. What was the nature of this "dust?" It could refer to creation based upon a previously-used body plan or genetic design. This would explain why human DNA shares similarity with the DNA of chimpanzees and other apes.

Biblical Data – Garden of Eden
Genesis 2:10, 14 Now a river flowed out of Eden to water the garden; and from there it divided and became four rivers. And the name of the third river is Tigris; it flows east of Assyria. And the fourth river is the Euphrates. The Bible describes the creation of man as having occurred in the Mesopotamian plain, near the Tigris and Euphrates Rivers. Genesis 2:10, 14 Now a river flowed out of Eden to water the garden; and from there it divided and became four rivers. And the name of the third river is Tigris; it flows east of Assyria. And the fourth river is the Euphrates.

Dating human origins: Adequate, but incomplete genealogies Ben and ab ~10, ,000 years ago The Bible does not give exact dates for the origin of modern humans. However, we can get an idea about the approximate date through the meanings of the original Hebrew language.

Incomplete Genealogies
Matthew 1:8 1 Chronicles 3:10-12 and to Asa was born Jehoshaphat; and to Jehoshaphat, Joram; and to Joram, Uzziah; Asa his son, Jehoshaphat his son, Jehoram his son, Ahaziah his son, Joash his son, Amaziah his son, Azariah [Uzziah] his son In the 16th century, Archbishop Ussher dated Earth’s origin at Saturday, October 9, 4004 B.C. by adding up all the genealogies presented in the Bible. These calculations were soon incorporated into the notes of virtually every English Bible - soon becoming equivalent to what "the Bible claimed" about the creation date of the earth. However, there are problems with this interpretation. There are provable gaps in at least some of the Old and New Testament genealogies. The table above shows that the genealogy given by the apostle Matthew drops three generations. However, Matthew intentionally listed the generations in groups of 141 and left out less important individuals. References Therefore all the generations from Abraham to David are fourteen generations; and from David to the deportation to Babylon fourteen generations; and from the deportation to Babylon to the time of Christ fourteen generations. (Matthew 1:17)

Incomplete Genealogies
Genesis 5-11 Luke 3:34-36 (reversed order) And Lamech… father of a son… Noah, (Genesis 5:28-29)... became the father of Shem. (Genesis 5:32)... The sons of Shem: Elam, Asshur, Arphaxad, Lud and Aram. (Genesis 10:22)... Arphaxad was the father of Shelah, and Shelah the father of Eber. Two sons were born to Eber: One was named Peleg (Genesis 10:24-25) the son of Serug, the son of Reu, the son of Peleg, the son of Heber, the son of Shelah, (Luke 3:35) the son of Cainan, the son of Arphaxad, the son of Shem, the son of Noah, the son of Lamech, (Luke 3:36) In contrast to Matthew, Luke's account of the biblical genealogies leading to Jesus Christ includes a generation not found in the Genesis account (Cainan). For this reason, we know that neither the Old Testament nor New Testament genealogies represent a complete record of all human generations. A more complete listing of gaps in the genealogical records can be found at “Are There Gaps in the Biblical Genealogies?” ( by William Henry Green, "Primeval Chronology” Bibliotheca Sacra (April, 1890),

ab – father, grandfather
Direct Descent? ben – son, grandson, etc. ab – father, grandfather The Hebrew word ben, besides the meaning of "son," can refer to a grandson, great-grandson, etc., since there is no other Hebrew equivalent. Likewise, the Hebrew word ab, besides the meaning of "father," can refer to a grandfather, great-grandfather, etc. For this reason, the biblical genealogies could represent highlights of the complete genealogy, with only the most noteworthy generations represented. Brown-Driver-Briggs' Hebrew Definitions: ben (Strong's H1121) son, grandson, child, member of a group son, male child grandson children (plural - male and female) youth, young men (plural) young (of animals) sons (as characterisation, i.e. sons of injustice [for unrighteous men] or sons of God [for angels]) people (of a nation) (plural) of lifeless things, i.e. sparks, stars, arrows (figuratively) a member of a guild, order, class originator or patron of a class, profession, or art of producer, generator (figuratively) of benevolence and protection (figuratively) term of respect and honour ruler or chief (specifically) Part of Speech: noun masculine A Related Word by BDB/Strong’s Number: from H1129 Same Word by TWOT Number: 254 ab (Strong's H1) father of an individual of God as father of his people head or founder of a household, group, family, or clan ancestor grandfather, forefathers - of person of people Part of Speech: noun masculine A Related Word by BDB/Strong’s Number: a root Same Word by TWOT Number: 4a Harris, R.L., G.L. Archer, and B.K. Wilke Theological Wordbook of the Old Testament, Vol. 1. Moody Press, Chicago, IL, pp. 5-6,

Direct Descent? NASB Alternate Translation
And Enosh lived ninety years, and became the father of Kenan. (Genesis 5:9) And Enosh lived ninety years, and became the father of the family line that culminated with Kenan. (Genesis 5:9) The flexible, literal meanings of the Hebrew words ben and ab allow for many more generations than are listed in the biblical genealogical records. Therefore, instead of referring to a direct son, the genealogy could be referring to a family line that culminated in the next named "son."

How Many Generations? Deuteronomy 7:9 1 Chronicles 16:15 Psalms 105:8
The Bible does give an idea of how many generations have lived under God's commandments. At least three verses in the Old Testament indicate that humans have been around for at least 1000 generations. Since a biblical generation is usually listed at 40 years, this would suggest that modern humans have existed for at least 40,000 years. References He has remembered His covenant forever, The word which He commanded to a thousand generations, (Psalms 105:8) Remember His covenant forever, The word which He commanded to a thousand generations, (1 Chronicles 16:15) "Know therefore that the LORD your God, He is God, the faithful God, who keeps His covenant and His lovingkindness to a thousandth generation with those who love Him and keep His commandments; (Deuteronomy 7:9) 1,000 gen x 40 yr/gen = 40,000 yr He has remembered His covenant forever, The word which He commanded to a thousand generations, (Psalms 105:8)

Scientific Predictions for the Origin of Humans
The biblical creation model does make scientific predictions. The following four slides list some of those predictions. Creation Model

Scientific Predictions
Similarities with Other Animals Anatomical – basic body plan Physiological – the way the body works Biochemical – the chemical pathways and machines that underlie everything The biblical creation model indicates through the Hebrew descriptions asa and yatsar that man was made or formed from pre-existing material or designs (see slide 9). Because of this, we would expect that humans would share anatomical, physiological and biochemical similarities with other animals.

Sudden appearance… Human fossils Human culture Spiritual activity The biblical creation model indicates that modern humans appeared suddenly. For this reason, we would expect to find a sudden appearance of modern human fossils, human culture (tools, abodes, art, etc.), and spiritual activity (items used in worship).

Origin of man: Traceable to a single man and a single woman Recent origin The biblical creation model indicates that modern humans were created from a single man and a single woman. Therefore, the genetics should indicate that our origins can be traced to this kind of creation event. The biblical dating indicates that this event would have occurred in the recent past (tens of thousands of years).

Origin of man: All males directly related to Noah All females directly related to Eve  Females should be more genetically diverse The Bible describes a genetic bottleneck event that occurred in human history. The Genesis flood killed all humans except Noah, his wife, his sons, and their wives. Since all males were genetically descended from Noah, but the females were genetically diverse, we would expect that female genetic diversity would be greater than male genetic diversity. This claim can be tested through an examination of mtDNA (mitochondrial DNA) compared to Y-chromosome genetic diversity.

Scientific Data for Human Origins
The next 66 slides examine the scientific data that pertains to the question of human origins.

Molecular Anthropology
Compare DNA sequences among modern human groups Similarities and differences Extent of differences Genetic differences among modern human people groups should provide evidence for the spread of humanity through the world. Those groups that exhibit the greatest genetic dissimilarity should represent the oldest populations. Therefore, the geographic location for the origin of modern humans can be determined from these studies.

Gives Date of humanity’s origin Original population size Genetic differences among modern human people groups should provide evidence for the spread of humanity through the world. Those groups that exhibit the greatest genetic dissimilarity should represent the oldest populations. Therefore, the geographic location for the origin of modern humans can be determined from these studies. There is some interplay between the date of the last common ancestor and the population size of the species. The smaller the assumed population size results in an earlier date for the last common ancestor. Therefore, neither value can be absolutely determined.

Gives Pattern for humanity’s spread Geographic location of humanity’s origin Comparing the genetic sequence of people groups allows scientist to determine how modern humans spread across the planet. For example, this evidence can be used to falsify the Book of Mormon account for the origin of Native Americans. Those groups that exhibit the greatest genetic dissimilarity should represent the oldest populations. Therefore, the geographic location for the origin of modern humans can be determined from these studies.

Genetic Diversity Evidence Mitochondrial DNA Y chromosomal DNA
Mitochondrial DNA (mtDNA) Male sperm contribute only genetic material and no cellular organelles. Therefore, all mtDNA comes from the egg, being passed down exclusively by females. Genetic Diversity Y chromosome A small chromosome that determines the sex of an individual. Embryos that posses a Y chromosome become male. Therefore, the genetic information on the Y chromosome is passed down only by males. Evidence Linkage disequilibrium The non-random association of alleles at different loci (or regions within DNA sequences), not expected from the law of independent assortment. Mitochondrial DNA Microsatellites Microsatellites" are loci where short sequences of DNA are repeated in tandem arrays (one right after the other). Y chromosomal DNA Linkage disequilibrium Scientists use several different tools to examine human genetic diversity. Most of these tools involve genetic sequences that are not subject to recombination, which would complicate the analysis of the data. Definitions Mitochondrial DNA (mtDNA) Male sperm contribute only genetic material and no cellular organelles. Therefore, all mtDNA comes from the egg, being passed down exclusively by females. Y chromosomal DNA A small chromosome that determines the sex of an individual. Embryos that posses a Y chromosome become male. Therefore, the genetic information on the Y chromosome is passed down only by males. Linkage disequilibrium The non-random association of alleles at different loci (or regions within DNA sequences), not expected from the law of independent assortment. Microsatellites Microsatellites" are loci where short sequences of DNA are repeated in tandem arrays (one right after the other). References Lynn B. Jorde, L.B., et al Microsatellite diversity and the demographic history of modern humans. Proc. Natl. Acad. Sci. USA 94: Microsatellites

Genetic Diversity Humanity had a recent origin African origin
Small population that rapidly expanded recently Scientists examine human genetic diversity using mitochondrial DNA, Y chromosomal DNA, linkage disequilibrium, and microsatellites. The results of the studies show that modern humans arose thousand years ago. The most genetically diverse populations are from Africa, suggesting an origin at or near that locale. The limited genetic diversity suggests that humans originated from a small population of individuals that expanded recently.

Human Chromosome 21 Diversity
Haplotype A combination of alleles (alternate forms of the same gene) of closely linked loci that are found in a single chromosome and tend to be inherited together Three haplotypes describe 80% of human population In a detailed genetic analysis of human chromosome 21, scientists have found that the vast majority of human populations around the globe fall into only three haplotypes. This limited degree of genetic diversity was unexpected for a species that, from an evolutionary viewpoint, had its origins millions of years ago. Definitions Haplotype A combination of alleles (alternate forms of the same gene) of closely linked loci that are found in a single chromosome and tend to be inherited together. Far fewer haplotypes than expected

Mitochondrial DNA Humanity originated less than 150,000 ya
Small population of women Single location (Africa) In the late 1980's and early 1990's a number of studies were done examining the mitochondrial DNA (mtDNA) of women all over the world. These studies, nicknamed the "Eve theory," suggested that the last common ancestor of modern man (actually women) appeared within the last 200,000 years (1-4), much more recently than previously thought. Refinements in the measurements lowered the original estimates to 135,000 years (4) and finally 100,000 years (5). Scientists chose to examine mtDNA because, being enclosed within the subcellular organelle called the mitochondrion, there is no genetic recombination (males make no contribution of mtDNA to the fetus). All mtDNA comes from our mothers and is passed down from mother to daughter, since only mitochondria from the egg are used to make up the fetus. By tracing the differences in mtDNA from peoples around the world, scientists have calculated the probable date of the last common ancestor of modern humans at 100,000 to 200,000 years ago. References R.L. Cann, M. Stoneking, A.C. Wilson Mitochondrial DNA and human evolution. Nature 325: 31. L. Vigilant, M. Stoneking, A.C. Harpending, K. Hawkes, A.C. Wilson African populations and the evolution of human mitochondrial DNA. Science 253: 1503. M. Hasegawa, S. Horai Time of the deepest root for polymorphism in human mitochondrial DNA. J. Mol. Evol. 32: 37. Stoneking M, Sherry ST, Redd AJ, Vigilant L New approaches to dating suggest a recent age for the human mtDNA ancestor. Philos. Trans. R. Soc. Lond. B Biol. Sci. 337: Whitfield, L.S., J.E. Suston, and P.N. Goodfellow Sequence variation of the human Y chromosome. Nature 378:

Y Chromosome Mapping Testis Determining Factor (TDF)
Channel Surfing (SRF) Addiction to death and destruction movies (T-2) The need to always be right (TLD-U) Spitting and hacking (P2E) Inability to express affection (ME-2) Finding humor in bodily noises (BLCH) Inability to put toilet seat down (BIDET) Selective hearing loss (MUM) Inability to ask directions (LST) Ability to write name with urine (CMeP) Seriously, the Y chromosome gives a reliable account of the generations of males. Since the vast majority of the Y chromosome cannot recombine with the X chromosome, it is passed from father to son without change unless a mutation occurs along the way. Following these mutations allows scientists to reconstruct the natural history of the Y chromosome, and, likewise, of all men.

Y Chromosome Data Study Total Base Pairs 95% CI Mean Pop. Size Lower
Upper Dorit, et al. 27,702 800,000 270,000 7,500 Hammer 39,000 51,000 411,000 188,000 5,000 Whitfield, et al. 91,500 37,000 49,000 43,000 N/A CI (Confidence Interval) A statistical measure of the certainty of a value. 95% CI means that there is a 95% probability that the result lies between the CI values. In 1995, scientists have examined human origins from the perspective of male genetics (1, 2). Scientists have examined a gene (ZFY), which being on the Y chromosome, is passed down only from father to son. Thirty-eight men were chosen from all over the world (Africa, Asia, Australia, Europe, and Northern, Central, and South America). Scientists determined the actual genetic sequence in each man for this gene, which is 729 base pairs long. To their surprise, all men had identical genetic sequences (over 27,000 base pairs analyzed). Scientists have calculated the most probable date for the last common ancestor of modern man, given the sequence diversity from modern apes. Using two different models this date is either 270,000 or 27,000 years ago. However, both these models assume that the male population during this entire period of time consisted of only 7,500 individuals. The date estimates from these models would be significantly reduced if the male population were higher than 7,500, which is very likely. Two separate studies using similar techniques looked at larger pieces of the Y chromosome, which would reduce the uncertainty in the calculation of dates. One study examined a gene which was 2,600 base pairs and determined a last common ancestor date of 188,000 year ago (minimum of 51,000 and maximum of 411,000 years ago) (3). The other study used a very large piece of the Y chromosome (18,300 base pairs) and calculated a last common ancestor date of modern man of 43,000 years ago (minimum of 37,000 and maximum of 49,000 years ago) (4). Definitions CI (Confidence Interval) A statistical measure of the certainty of a value. 95% CI means that there is a 95% probability that the true result lies between the CI values. References S. Paabo The Y chromosome and the origin of all of us (men). Science 268: 1141. R.L. Dorit, H. Akashi, W. Gilbert Absence of polymorphism at the ZFY locus on the human Y chromosome. Science 268: 1183. Hammer, M.F A recent common ancestry for human Y chromosomes. Nature 378: Whitfield, L.S., J.E. Suston, and P.N. Goodfellow Sequence variation of the human Y chromosome. Nature 378:

Male vs. Female Divergence
Age of Coalescence Y (Male) mtDNA (Female) Minimum 37,000 120,000 Maximum 49,000 474,000 In 1995, the Whitfield study examined both mtDNA and Y chromosome genetics to compare the divergence times for each. To their surprise, the dates did not match - males diverged much later than females. The "discrepancy" can be explain through the biblical creation model. The Bible describes a genetic bottleneck event that occurred during the Genesis flood. Since all males on the ark were genetically descended from Noah, but the females were genetically diverse, we would expect that female genetic diversity would be greater than male genetic diversity. This biblical model is confirmed through an examination of mtDNA (mitochondrial DNA) compared to Y-chromosome genetic diversity. Whitfield, L.S., J.E. Suston, and P.N. Goodfellow Sequence variation of the human Y chromosome. Nature 378:

Y Chromosome Summary Humanity originated less than 50,000 ya
Small population of men Single location (Africa) Studies on human Y chromosomal DNA show that modern humans arose less than 50,000 years ago from a small population of men, probably in Africa.

Linkage Disequilibrium
Humanity originated less than 50,000 ya A study published in 1996 (1) examined linkage disequilibrium at the human CD4 locus (a T-cell associated antigen) as a means to establish the date of modern human origins. This study determined a maximum origin date of 102,000 years ago based upon the assumption that the Alu (-) allele arose 5 million years ago, or almost immediately after mankind's split from other primates. As they stated, "It is likely that the Alu deletion event occurred more recently, in which case our estimates for the date of founding of the non-African populations would also be more recent." Preliminary studies from chromosomes 19, 11 and 8 show similar results to that seen on chromosome 12 (the locus of the CD4 gene) (2). References Tishkoff, S.A., E. Dietzsch, W. Speed, A.J. Pakstis, J.R. Kidd, K. Cheung, B. Bonn-Tamir, A.S. Santachiara-Benerecetti, P. Moral, M. Krings, S. Paabo, E. Watson, N. Risch, T. Jenkins, and K.K. Kidd Global patterns of linkage disequilibrium at the CD4 locus and modern human origins. Science 271: Fischman, J Evidence mounts for our African origins - and alternatives. Science 271: 1364.

Origin of the Malaria Parasite
Originated less than 120,000 ya Resistance alleles appeared 3,000-12,000 ya Depending upon which study one examines the alleles that confer malarial resistance arose either 120,0001 or 3,000-12,0002 year ago. References Mu, J., J. Duan, K. D. Makova, D. A. Joy, C. Q. Huynh, O. H. Branch, W. Li and X. Su Chromosome-wide SNPs reveal an ancient origin for Plasmodium falciparum. Nature 418: 323–324. Tishkoff, S.A., et al Haplotype Diversity and Linkage Disequilibrium at Human G6PD: Recent Origin of Alleles That Confer Malarial Resistance. Science 293:

Sudden appearance of modern humans in the fossil record
Scientific Data 1500 Homo Sudden appearance of modern humans in the fossil record 1000 Cranial Capacity (cc) Paleontological discoveries and geochronology show that the pattern of morphological change in the hominid fossil record was not progressive, but abrupt (1). Primitive craniodental complexes (similar to the reconstructed last common ancestor with the African great apes) were found in nearly all species of Hominidae (2). Relative brain size increased slightly among successively younger species of Australopithecines, although many Australopithecine skulls have brain capacities no larger than those of chimpanzees. (3, 4). However, brain capacities expanded abruptly with the appearance of Homo, but within early Homo remained at about half the size of Homo sapiens for almost a million years. The fossil record indicates an accumulation of relatively rapid shifts in successive species, and certainly not any kind of gradualistic changes. References Wood B Origin and evolution of the genus Homo. Nature 355: McHenry H.M Body size and proportions in early hominids. Proceedings of the National Academy of Sciences of the United States of America 91: Dean Falk Hominid brain evolution: looks can be deceiving. Science 280: 1714 Conroy, G.C., G.W. Weber, H. Seidler, P.V. Tobias, A. Kane, and B. Brunsden Endocranial capacity in an early hominid cranium from Sterkfontein, South Africa. Science 280: 500 Australopithecines 1 2 3 Time (MYA)

Sudden appearance of human culture:
Scientific Data Sudden appearance of human culture: Sophisticated tool kit Socioeconomic organization Art work Spiritual expression Not only did modern humans appear suddenly in the fossil record, but the record of their activities also appeared suddenly at this time. The next five slides will examine some of the aspects of the sudden appearance of human culture. References Clark, G.A Highly visible, curiously intangible. Science 283:

Sophisticated Tool Kit
A shift from predominantly “rake” to “blade” stone tool technology Increased variety and complexity of stone tools involving a higher degree of “imposed form” Complex and extensively shaped bone, antler, and ivory artifacts Increased regional diversification of tool forms Although primitive tools can be found in the fossil record for millions of years, the appearance of modern humans brought a sudden increase in complexity and design of these tools. References Clark, G.A Highly visible, curiously intangible. Science 283:

Socioeconomic Organization
Specialized patterns of animal exploitation, based on systematic hunting A sharp increase in the overall density of human population An increase in the maximum size of local residential groups Appearance of highly “structured” sites, including hearths, pits, huts, tents, and other habitations Along with the appearance of modern humans came sudden changes in the socioeconomic organization of human culture. Modern humans lived together in large groups that cooperated as societal units. References Clark, G.A Highly visible, curiously intangible. Science 283:

Appearance of Modern Art
Sophisticated works of art first appear in the fossil record about 30,00-40,000 years ago.1-3 Paleoanthropologists have referred to this as the "big bang" of artistic expression. The quality of the artistic expression in these ancient works of art is spectacular. For example, in the recently discovered Grotte Chauvet caves, which contain the oldest advanced cave art yet discovered (dated at 32,000 years ago), the quality of the art work is so remarkable that it has demolished all previous chronologies for the development of artistic techniques such as shading and perspective. References Tim Appenzeller Art: Evolution or Revolution. Science 282: Michael Balter New Light on the Oldest Art. Science 283: Klein, R.G Evolutionary Anthropology 1: 5-14. Balter, M Restorers reveal 28,000-year-old artworks. Science 283: 1835.

Body Ornaments Dated at 40,000 years ago No food value
Unusual designs and color Soon after the appearance of modern humans came ornaments that were used to adorn people's bodies. These items had no practical use, but were used for purely ornamental purposes. References Kuhn, S.L., M. C. Stiner, D. S. Reese, and E. Güleç. Ornaments of the earliest Upper Paleolithic: New insights from the Levant. Proc. Natl. Acad. Sci. USA 98:

Spiritual Expression Religious relics and altars date to 24,000 ya
Artwork containing spiritual content dates to 5,000 ya Spiritual expression does not appear in the anthropological record until 24,000 years ago.1, 2 The Bible says that God created modern humans as spiritual creatures, so we would not expect to see this kind of expression in any other hominid species. References Simon, C Stone-age sanctuary, oldest known shrine, discovered in Spain. Science News 120: 357. Bower, B When the human spirit soared. Science News 130:

Deleterious Mutations
Overall Deleterious Conservative 4.2 1.6 Realistic 6.7 3.1 "The deleterious mutation rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if mutational effects on fitness were to combine in a multiplicative way." Evolutionists are faced with a serious problem in explaining how hominids could have evolved given their high rate for accumulation of deleterious mutations, and their extremely low reproductive rates. How do these harmful mutations get removed as one species evolves into another? If evolution is correct, then the hominids should have become extinct many millions of year ago, due to the accumulation of these bad mutations. References Eyre-Walker, A. & Keightley, P. D High genomic deleterious mutation rates in hominids. Nature 397: Eyre-Walker, A. & Keightley, P. D High genomic deleterious mutation rates in hominids. Nature 397,

Evidence Against the Design of Humans?
Pseudogenes present in great apes and humans Pseudogenes Regions of non-coding DNA (DNA that does not code for functional protein) that have been apparently duplicated from functional genes. Beta globin Enolase Vitamin C Assumes that God would never reuse previous designs It has been argued that the presence of apparently copied, non-functional DNA sequences (known as pseudogenes) support the theory of evolution and invalidate the idea that an intelligent Agent created life on earth. Until 2003, no function had been found for any pseudogene. However, like other classes of non-coding DNA, a regulatory function has been found for at least one mammalian pseudogene.1 This finding destroys the evolutionary argument that these genes are merely evolutionary mistakes. The idea that God would not create pseudogenes or include them in a species template that contained a pseudogene makes a theological conclusion about the nature of God. Definitions Pseudogene A genetic sequence of apparently copied, "non-functional" DNA that supposedly originated from a once-functional gene. References Hirotsune, S., Yoshida, N., Chen, A., Garrett, L., Sugiyama, F., Takahashi, S., Yagami, K., Wynshaw-Boris, A., and Yoshiki, A An expressed pseudogene regulates the messenger-RNA stability of its homologous coding gene. Nature 423:

Summary - Scientific Data
Humans originated from a small population of males and females Recent origin of modern humans ~ 50,000 years ago Humans originated suddenly and dramatically The scientific data shows that humans originated from a small population of males and females within the last 50,000 years, in a sudden and dramatic appearance - what one would expect from a biblical creation model.

Origin of Man “Out-of-Africa” Hypothesis
African Humans European Humans Asian Neandertals H. antecessor ? ? The "Out of Africa" evolutionary hypothesis states that modern humans arose from Neandertals or other species of the genus Homo (Homo antecessor, Homo ergaster). The next 14 slides examine the possible role of Neandertals as ancestors of modern humans. H. ergaster

Who were the Neandertals?
Were the Neandertals the ancestors of modern humans? Let's look at who they were and if they could have been our ancestors.

Who Were the Neandertals?
Lived ~150,000 to ~30,000 years ago Inhabited Europe and western Asia The Neandertals lived between 150,000 and 29,000 years ago in Europe and western Asia.1 Geographically and chronologically, their existence overlapped with that of modern humans. References Roger Lewin, Principles of Human Evolution (Malden, MS: Blackwell Science, Inc., 1998), p. 365.

Who Were the Neandertals?
Physical similarities with modern humans Bipedal (bipedalism) Ability to walk upright on two legs. Bipedal Large brain capacity Superficially, the Neandertals seemed to be similar to modern humans. Both are obligate bipeds with large brains. However, that is where much of the similarity ends. The next slides will examine their differences from us.

Physical Differences Between Neandertals and Humans
Brain shape Receding forehead Modern Human Neandertal Modern Human Neandertal Brow ridge Large eye sockets Large front teeth Occipital bun The Neandertal skull is quite different from a modern human skull. The brain case is squashed in the Neandertal. The skull also features a receding forehead and receding chin. Neandertals had large eye sockets, a prominent brow ridge, and large front teeth. There was a large retromolar gap between the last molar and the lower jaw, and an occipital bun (bump) at the back of the skull. References Christopher Stringer and Robin McKie, African Exodus. The Origins of Modern Humanity (New York, NY: Henry Holt and Company, 1996), pp Retromolar gap Chin receding

Foramen magnum The area where the spine joins the skull Pterygoid tubercle A small rounded nodule on the Pterygoid bone in the roof of the mouth connecting the palatine in front and the quadrate behind. Elongated foramen magnum Medial pterygoid tubercle Flatter skull base Instead of a nearly round foramen magnum, Neandertals have one that is elongated. Definitions Foramen magnum The area where the spine joins the skull. Medial pterygoid tubercle A small rounded nodule on the Pterygoid bone in the roof of the mouth connecting the palatine bone in front and the quadrate bone behind.

Chimp Neander. Human Large nose Large sinuses Structure of the inner ear Neandertals had large noses and sinus cavities.1 Since they lived in cold climates, this design would help them warm the air they breathed. Neandertals exhibit differences in their inner ear bones, the structure of which lies between that of chimpanzees and humans.2 The higher larynx implies that Neandertals probably did not have the ability to speak.1 References Christopher Stringer and Robin McKie, African Exodus. The Origins of Modern Humanity (New York, NY: Henry Holt and Company, 1996), pp Higher larynx

Thicker bones Barrel chests Shorter limbs Asymmetrical humerus Metacarpals The bones that connect the wrist bones (carpals) with the finger bones (phalanges). One of the characteristic of the Neandertals is their stocky appearance. They appear this way because of their thicker bones, barrel chests, and shorter arms and legs.1 Scientists recently discovered a probable reason for their asymmetrical humerus (upper arm bone). Neandertals possessed spears, but they probably did not throw them.2 The atlatl, or spear thrower, first appears in the fossil record at 19,000 years ago. Stone points that look like they were designed to be used with thrown spears date back to about 35,000 years ago. Thrusting a spear would be expected to produce the asymmetry observed in Neandertal upper arm bone. The thicker metacarpals (bones in the palm of the hand) have significant implications in the ability of Neandertals to perform fine motor functions. 3D digital maps of the surfaces of the metacarpals reflect the kind of grip these creatures had.3, 4 These maps suggest that the smaller, slimmer hands of early modern humans were better suited to oblique grips - used when holding a complex tool with a handle, such as a hammer. Neanderthals, by comparison, were limited to grips as one has when holding a stone or baseball. Such a grip would have been powerful (you wouldn't want to shake hands with a Neanderthal), but not very dexterous. The anatomy of the Neanderthals would have prevented them from engaging in fine motor skills, such as carving and painting. Definitions Humerus The bone that connects the lower arm bones (radius and ulna) with the shoulder bone (scapula). Metacarpals The bones that connect the wrist bones (carpals) with the finger bones (phalanges). References Christopher Stringer and Robin McKie, African Exodus. The Origins of Modern Humanity (New York, NY: Henry Holt and Company, 1996), pp Kurt Kleiner Neanderthals used both hands to kill. New Scientist, November 23, 2002. Clarke, T Relics: Early modern humans won hand over fist. Nature. Niewoehner, W. A Behavioral inferences from the Skhul/Qafzeh early modern human hand remains. Proceedings of the National Academy of Sciences. Thicker metacarpals

Neandertal Development
Craniodental A fancy word referring to the skull and teeth Neandertal Development Craniodental development of Neandertals and humans differs from before birth Differences occur from the time Neandertals first appear Craniodental development of Neandertals and humans differs from before birth. These differences occur from the time Neandertals first appear. Definitions Craniodental A fancy word referring to the skull and teeth. References Harder, B Telltale Face Betrays Neandertals as Non-Human. National Geographic, August, 2001. Marcia S. Ponce de León, Christoph P. E. Zollikofer Neanderthal cranial ontogeny and its implications for late hominid diversity. Nature 412:

Molecular Paleontology: Neandertal mtDNA
40,000 YA Neander, Germany 29,000 YA Northern Caucasus 40,000 YA Vindija Cave, Croatia The next 5 slides examine the results of molecular paleontology studies using Neandertal mtDNA. Two specimens from Neander, Germany were dated at 40,000 ya. A third from Croatia was also dated at 40,000 ya, and the last from the Northern Caucasus was dated at 29,000 ya. References Krings, M., A. Stone, R. W. Schmitz, H. Krainitzki, M. Stoneking, and S. Paabo Neandertal DNA Sequences and the Origin of Modern Humans. Cell 90: Ovchinnikov, I.V., A. Gotherstrom, G. P. Romanovak, V. M. Kharitonov, K. Liden, and W. Goodwin Molecular analysis of Neanderthal DNA from the northern Caucasus. Nature 404: Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. Grossschmidt, G. Possnert, M. Paunovic, and S. Pääbo A view of Neandertal genetic diversity Nature Genetics 26:

DNA 101 DNA language: 4 “letters” in the alphabet
A – Adenine T – Thymine C – Cytosine G – Guanine 20 3-letter “words” (codons) Each codon codes for one amino acid Unlimited number of “sentences” (proteins) Unlimited number of “novels” (organism) DNA has been described as a language, since it encodes massive amounts of information. The language consists of only four letters (called "base pairs" or "bases" - adenine, guanine, thymine, or cytosine) that are bound to a phosphorylated sugar - deoxyribose. The bases (or letters) are organized into 64 "words" or codons that specify a particular amino acid. However, the DNA code is redundant in that some similar codons code for the same amino acids. In addition, some codons code for no amino acids at all, but indicate where the code begins or ends. Ultimately, the 64 codons code for 20 amino acids. The codons are organized into "chapters" or genes that code for proteins. Since the genes are of different lengths, there are a virtually unlimited number of possible proteins that can be produced. The genes ultimately make up all the information that is required to complete the "novel," which is the organism for which it codes. The human genome (entire genetic code) consists of 3 billion bases (or letters) and approximately 30,000 genes.

Neandertal mtDNA mtDNA Sample (HVR-1)
Sequence Number (Read Down) Mod. Human AATTCCCCGACTGCAATTCACGCAC-CATCCTC Chimpanzee ......T.ATT.....ACTGAAA....G.... Neander.#1 GG.CTTTTATTC.T.CCCTGTAAGTATGCT.CT Neander.#2 .C.....ATT.ATCCCCTGTAA.TATGCTTC Neander.#3 GG......ATTC.TCCCCTGTAAGTATGCT.C Neander.#4 GG......ATTC.TCCCCTGTAA.TATGCT.C The table above shows the sequence differences found between modern humans and the four Neandertal remains analyzed to date. On average, the Neandertal sequences differed from the modern human sequence by 25 base pairs. By comparison, the average variation among modern humans is only 8 base pairs, all the base pairs of which are at different loci than the Neandertal differences. The analysis of the second sample was extremely important, since it was dated at 29,000 years ago - only 1000 years before the last Neandertal disappeared. If Neanderthals and humans had interbred, one should have expected to see this in the last remnants of the Neandertals. In addition, since the Neandertal fossils were separated geographically by over 2,500 km, it shows that Neandertals were a homogeneous species. The researchers conclusion: "Neanderthals were not our ancestors" - a quote from the authors of the first study. In fact, the differences between modern humans and Neandertals were so great that calculations indicated that the last common ancestor (according to evolutionary theory) must have existed 550,000 to 690,000 years ago (first study) and 365,000 to 853,000 years ago (second study). References Krings, M., A. Stone, R. W. Schmitz, H. Krainitzki, M. Stoneking, and S. Paabo Neandertal DNA Sequences and the Origin of Modern Humans. Cell 90: Ovchinnikov, I.V., A. Gotherstrom, G. P. Romanovak, V. M. Kharitonov, K. Liden, and W. Goodwin Molecular analysis of Neanderthal DNA from the northern Caucasus. Nature 404: Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. Grossschmidt, G. Possnert, M. Paunovic, and S. Pääbo A view of Neandertal genetic diversity Nature Genetics 26: Schmitz, R. W., Serre, D., Bonani, G., Feine, S., Hillgruber, F., Krainitzki, H., Pääbo, S. & Smith, F. H The Neandertal type site revisited: Interdisciplinary investigations of skeletal remains from the Neander Valley, Germany. Proceedings of the National Academy of Science USA 99:

Neandertals – Limited Genetic Diversity
Population # Individuals mtDNA differences Mean Min. Max. Neandertals 3 3.73 - Humans 5,530 3.43 0.00 10.16 Chimpanzees 359 14.81 29.06 Gorillas 28 18.57 0.40 28.79 Although the differences between modern humans and Neanderthals are large, the differences among individual humans or among individual Neanderthals is small compared to other apes (see Table above). Such low genetic diversity among Neanderthals are consistent with a creation model in which Neanderthals were specially created as a small population in the relatively recent past. The much larger variation seen among chimpanzees and gorillas does not eliminate them as specially created, but does place their probable creation date considerably before that of modern humans. References Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. Grossschmidt, G. Possnert, M. Paunovic, and S. Pääbo A view of Neandertal genetic diversity. Nature Genetics 26:

Ancient Modern Human mtDNA
mtDNA Sample (HVR-1) Age (ka) Sequence Number (Read Down) Modern Human ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA Aboriginal ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C... Chimp ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C.. Neander #1 30+ GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C... Ancient Aussie 62 T.G CT.T....T..T......TC....G Knowing the variation of sequences between modern humans and Neanderthals is important in determining if Neanderthals contributed to the human gene pool. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first of these studies was published in 2001, examining the mtDNA sequences of 10 ancient Australians (1). A summary of the HVR-1 sequence of these individuals (compared with the modern human reference sequence, modern Aboriginal polymorphism, Neanderthals, and chimpanzees) can be found in Table 3, below. The first thing that one notices is that the sequence variation of ancient humans compared to modern humans is at most 10 base pairs (in LM3, the most ancient specimen), which is nearly equal to the average variation among modern humans population groups, which is 8 base pairs. LM3, dated at 40,000 years old (redated from the original estimate of 62,000 years old, 2), varied the most from the modern human reference sequence, but this variation included only three bases shared with Neanderthal specimens. Since LM3 was a contemporary (or lived even earlier than the Neanderthals sequenced to date), it is apparent that the human genome was already nearly "modern" before Neanderthals died out. Of the ten sequence differences between LM3 and the modern human reference sequence, five of those bases correspond to polymorphisms found in modern Aboriginal people, leaving only a five base difference - certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 40,000 years stands in sharp contrast to the large differences seen between modern humans and Neanderthals. A second study examined the mtDNA sequences of two Cro-Magnon specimens dated to 23,000 and 25,000 years old (3). One specimen (Paglicci-25) had no sequence differences from the modern reference sequence, and the other (Paglicci-12) only one substitution (see table below). It is remarkable that so little change in the sequence had occurred over the last 23,000 years of human "evolution." References Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne Mitochondrial DNA sequences in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: Bowler, J. M., Johnston, H., Olley, J. M., Prescott, J. R., Roberts, R. G., Shawcross, W., and Spooner, N. A New ages for human occupation and climatic change at Lake Mungo, Australia. Nature 421: Caramelli, D., C. Lalueza-Fox, C. Vernesi, M. Lari, A. Casoli, F. Mallegnii, B. Chiarelli, I. Dupanloup, J. Bertranpetit, G. Barbujani, and G. Bertorelle Evidence for a genetic discontinuity between Neandertals and 24,000-year-old anatomically modern Europeans. Proceedings of the National Academy of Science USA 100:

Neandertal mtDNA Summary
Neandertals have no genetic (nor evolutionary) connection to humans Neandertals displayed limited genetic diversity The scientific data show that Neandertals have no genetic connection to modern humans. Although it is remotely possible that Neandertal males could have contributed to the genetic information of modern humans, it seems unlikely due to the lack of clear hybrids in the fossil record and the lack of Neandertal features in modern humans. The limited genetic diversity of Neandertal remains suggest that these creatures did not breed with other hominids (including modern man), but went extinct, leaving no descendants.

Origin of Man Classic Hypothesis
African Humans European Humans Asian Humans Neandertals H. antecessor The classic evolutionary hypothesis stated that a series of Homo species (Homo ergaster and Homo antecessor) evolved into Neandertals (Homo neandertalensis, formerly Homo sapiens neandertalensis), which gave rise to modern humans (Homo sapiens). However, this hypothesis has been disproved by the fact that Neandertals could not be our ancestors. Even so, other evolutionary hypotheses have taken its place... H. ergaster

Origin of Man Multi-regional Hypothesis
African Humans ? European Humans ? Asian Humans ? Neandertals ? H. erectus H. antecessor H. ergaster The multiregional hypothesis states that modern humans evolved from several different groups of hominids (Homo ergaster, Homo erectus, Homo antecessor, and Homo neandertalensis) that interbred at some point to produce different races or groups of modern humans.

Multiregional Hypothesis Requires
Large breeding populations over the entire planet Frequent interbreeding of those populations Genetic roots traceable to millions of years bp The multiregional hypothesis makes certain predictions about the nature of the hominid fossil record and the genetics of modern humans. These claims can be tested directly through genetic studies of human populations. References Harpending, H.C., et al Genetic traces of ancient demography. Proc. Natl. Acad. Sci. USA 95:

Genetic Data Contradicts Multiregional Hypothesis
Study 1 African and Asian and oceanic peoples originated from same population group kya Study 2 90% of founding population must come from Africa and this population must be small The multiregional hypothesis is contradicted by a large body of genetic evidence. Genetic studies of worldwide human populations show that all groups can trace their origins to a small group of African ancestors.1, 2 References Gibbons, A Modern Men Trace Ancestry to African Migrants. Science 292: Yuehai Ke, et al African Origin of Modern Humans in East Asia: A Tale of 12,000 Y Chromosomes. Science 292:

Genetic Data Contradicts Multiregional Hypothesis
Study 3 (small population size) Nuclear DNA sequences Alu insertions HLA exons mtDNA mismatch distributions frequency spectra (mtDNA, Y-chr) allele size vs. homozygosity at tandem repeat loci Seven independent measures of genetic diversity among human populations indicate that the founding human population must have been very small.1 This genetic evidence contradicts the multiregional hypothesis, which requires the presence of large interbreeding populations of hominids. References Harpending, H.C., et al Genetic traces of ancient demography. Proc. Natl. Acad. Sci. USA 95:

Homo erectus Development
Homo erectus developed in a fashion similar to great apes – not modern humans Homo erectus developed from infanthood to adulthood rapidly The fossil record indicates that Homo erectus developed in a fashion similar to great apes – not modern humans, and that they developed from infants to adults rapidly.1 References Dean C, Leakey MG, Reid D, Schrenk F, Schwartz GT, Stringer C, Walker A Growth processes in teeth distinguish modern humans from Homo erectus and earlier hominins. Nature 414:

Descent of Modern Humans
“Most of the familiar specimens of Homo erectus and of archaic humans known from the Pleistocene were not members of populations ancestral to us” Scientists are beginning to recognize that the hominid fossil record is littered with species that could not have been ancestors of modern humans.1 A creation model in which one template was used to produce modern humans fits the data better than the multiregional model. Even the National Geographic,2 which is extremely evolutionary in their perspective, contained a telling graphic in a recent article. The graphic showed two possible scenarios – one of direct descent and a second as a series of species with no descent indicated - indicating a growing acknowledgment in anthropologic circles - that scientists don't really know who man's ancestors are and what, if any, species might lie in the line of descent to modern man. References Harpending, H.C., et al Genetic traces of ancient demography. Proc. Natl. Acad. Sci. USA 95: Gore, R New Find. National Geographic. August, 2002, p. 2. Harpending, H.C., et al Genetic traces of ancient demography. Proc. Natl. Acad. Sci. USA 95:

Origin of Man Multi-regional Hypothesis
African Humans European Humans Asian Humans ? ? ? Neandertals ? H. erectus ? H. antecessor The multiregional hypothesis states that modern humans evolved from several different groups of hominids (Homo ergaster, Homo erectus, Homo antecessor, and Homo neandertalensis) that interbred at some point to produce different races or groups of modern humans. The fossil record and genetic evidence contradict this hypothesis. H. ergaster

Similarities with other animals
Scientific Data Similarities with other animals Anatomical – overall structure and body plan Physiological – how the body systems work and interact Biochemical – basic chemical pathways The biblical creation model indicates through the Hebrew descriptions asa and yatsar that man was made or formed from pre-existing material or designs (see slide 9). Because of this, we would expect that humans would share anatomical, physiological and biochemical similarities with other animals. Scientific data shows that humans share a large number of biological similarities with other mammals, especially primates and apes. The next five slides will examine some of these similarities and differences.

Scientific Data Human – Chimpanzee genetics ~95-99% Genetic Similarity
Base substitutions – 1.4% Insertions/Deletions – 3.4% Common Descent (?) Scientific data shows that humans share a high degree of genetic similarity to the apes, especially chimpanzees. Before 2002, it was commonly claimed that humans differed genetically from chimpanzees by 1-2%. However, following the completion of the human genome project's complete genetic sequence, and the beginning of the chimpanzee genome sequence, we now have a much better estimate of the genetic difference. Gene sequence differences are very close to what had been previously estimated at 1.4%. However, there are quite a few insertions and deletions found in comparing the two sequences. These differences equal 3.4%. Therefore, the total genetic difference between chimpanzees and humans is now seen as being 4.8%1 - much larger than previously thought. Such a large genetic difference now brings into question the paradigm of common descent. References Britten, R.J Divergence between samples of chimpanzee and human DNA sequences is 5%, counting indels. Proc. Natl. Acad. Sci. USA 99:

Humans and Chimpanzees
Chromosome number Human (46) Chimp (48) Chromosome sizes Chromosomal banding #2 equivalent to two smaller chimp chromosomes #4 and #17 different Humans have two fewer (one pair) chromosomes compared to chimpanzees . However, human chromosome 2 seems to be a combination of two smaller chromosomes found in apes. Most of the human and chimpanzee chromosomes have similar banding patterns, indicating similar overall structure. However, chromosomes 4 and 17 exhibit different banding patterns in humans and also among different species of apes.

Chromosome 21 Human-Chimp Comparison
HS21 Clone Gaps PCR Result Chimp- Chimp and other primates- Chromosome 21 fully sequenced and annotated Two clusters with significant differences A first-generation human-chimpanzee comparative genome map was made by scientists who paired alignment of 77,461 chimpanzee bacterial artificial chromosome end sequences with the recently published human genome sequence.1 They detected two clusters on human chromosome 21 that suggest large, nonrandom regions of difference from the chimpanzee genome. References Fujiyama, A. et al Construction and Analysis of a Human-Chimpanzee Comparative Clone Map. Science 295:

How Different From Chimpanzees?
Human problem – anthropomorphizing The counting dog What do chimpanzees really understand? Scientists are not immune to the common problem of anthropomorphizing. We tend to look at all other animals through human consciousness. However, when conditioning is stripped away, animal brains do not work anything like the conscious human brain. A favorite trick I used to do with my friends was to introduce them to the "counting" dog. My parents had this terrier mix that was quite "intelligent" by dog standards. I would ask my friend to pick a number between one and five. I would hold up that number of fingers, and the dog would bark out the count. What my friends didn't know (and never caught onto) was that the dog would bark as long as I held up my hand. As soon as the dog reached the correct "count" I would put my hand down and the dog would be finished "counting." Insight into how chimpanzees really think can be seen in some recent experiments performed by Dr. Povinelli. In these experiments, the researchers used the chimpanzees' natural begging gesture to examine how they really think about their world. They confronted the chimpanzees with two familiar experimenters, one offering a piece of food and the other holding out an undesirable block of wood. As expected, the chimpanzees had no trouble distinguishing between the block and the food and immediately gestured to the experimenter offering the food. Next, the researchers wanted to see if the chimpanzees would be able to choose between a person who could see them and a person who could not. If the chimpanzees understood how other animals see, they would gesture only to the person who could see them. The researchers achieved the "seeing/not-seeing" contrast by having the two experimenters adopt different postures. In one test, one experimenter wore a blindfold over her eyes while the other wore a blindfold over her mouth. In the other tests, one of the experimenters wore a bucket over her head, placed her hands over her eyes or sat with her back turned to the chimpanzee. All these postures were modeled after the behaviors that had been observed during the chimpanzees' spontaneous play. The results of the experiments were astonishing. In the tests involving blindfolds, buckets and hands over the eyes--the apes entered the lab and paused but then were just as likely to gesture to the person who could not see them as to the person who could. In several cases, the chimpanzees gestured to the person who could not see them and then, when nothing happened, gestured again, as if puzzled by the fact that the experimenter did not respond. In the case of experimenters facing with their backs to the chimpanzees, they performed as if they knew that those facing way from them could not see and offer them food. However, subsequent experiments proved that the chimpanzees had merely responded to conditioning from the initial experiments, since they had only received food from those experimenters who faced them. This was proven by having experimenters facing away from the chimpanzees, but then turning to look over their shoulders. The chimpanzees were just as likely to gesture to the experimenters facing away as the one who turned to look at them. Chimpanzees have no clue that humans must face them in order to see. It is obvious from these experiments that chimpanzees lack even a simple understanding of how their world works, but merely react to conditioning from directly observable events. “Humans constantly invoke unobservable phenomena and variables to explain why certain things are happening. Chimpanzees operate in the world of concrete, tangible things that can be seen. The content of their minds is about the observable world.” References Povinelli, D.J Animal Self-Awareness: A Debate Can Animals Empathize? Scientific American.

Decreased size of back teeth
Human Distinctives Large brain size Bipedalism Advanced culture Decreased size of back teeth Modern humans have extremely large brains, which requires a large amount of energy to operate. In the fossil record, brain size increased slightly among successively younger species of Australopithecines, although many Australopithecine skulls have brain capacities no larger than those of chimpanzees. (1, 2). However, brain capacities expanded abruptly with the appearance of Homo, but within early Homo remained at about half the size of Homo sapiens for almost a million years. The fossil record indicates an accumulation of relatively rapid shifts in successive species, and certainly not any kind of gradualistic changes. The next 12 slides will examine bipedalism among the hominids to see if it fits any kind of evolutionary theory. References Dean Falk Hominid brain evolution: looks can be deceiving. Science 280: 1714 Conroy, G.C., G.W. Weber, H. Seidler, P.V. Tobias, A. Kane, and B. Brunsden Endocranial capacity in an early hominid cranium from Sterkfontein, South Africa. Science 280:

Emergence of Bipedalism
The prevailing evolutionary theory to account for the appearance of bipedalism is that the habitat of the hominids changed from woodland to open savanna. Under these conditions, erect posture would be helpful in detecting predators and maintaining body temperature. However, with recent studies pushing bipedalism back to at least 4 million years, the woodland habitat does not provide the proper driving force to select for the appearance of a bipedal stance. References Reed, Kaye E., Early hominid evolution and ecological change through the African Plio-Pleistocene. Journal of Human Evolution 32: Driven by habitat change from wood-land to open savanna?

Bipedalism Theories Theory Problems Ecology (Woodland to Savanna)
Occurred later1 Hunting and tools Thermoregulation2 Enhanced vision Wrong environment Male provider3 hominids were reproductively disadvantaged4 Scarce dietary resources Not fully supported by the data Bipedalism uses twice the energy as mammalian quadrupedalism. Therefore, one would expect to find a fairly robust theory to explain why hominids opted to use so much energy to get around. Most evolutionary theories constructed to account for the appearance of bipedalism have serious problems, since they rely upon the change from woodland to savanna habitat, which occurred after bipedalism arose. This eliminates the ecology, the thermoregulation, and the enhanced vision hypotheses. The original hunting hypothesis (proposed by Charles Darwin) has been invalidated, since the appearance of hunting tools were much later than the appearance of bipedalism. The male provider model states that monogamous males provided for pregnant/nursing mates and their offspring. All available evidence indicates that early hominids were polygynous and not monogamous and that male provisioning of immobile females and offspring was unlikely. No monogamous primate species is known to have a male who provides food for the female and her offspring. Even so, in hunter/gatherer societies, the average human female gathers an estimated 12,000 calories per day in food while the male averages only about 7,230 calories. So much for male provisioning! The final explanation was that scarce dietary resources required an efficient means of travel. In the late Miocene, hominid dietary resources become thinly dispersed in some areas, requiring possible extensive travel to exploit those resources. Why energy-consuming bipedalism, as opposed to quadrupedalism, would be chosen as the means of travel, remains a question. References Reed, Kaye E., Early hominid evolution and ecological change through the African Plio-Pleistocene. Journal of Human Evolution 32: Wheeler, P. E., The thermoregulatory advantages of hominid bipedalism in open equatorial environments: the contribution of increased convective heat loss and cutaneous evaporative cooling. Journal of Human Evolution 21: Hunt, Kevin D., The postural feeding hypothesis: an ecological model for the evolution of bipedalism. South African Journal of Science 92:77-90. McHenry, H.M The pattern of human evolution: Studies on bipedalism, mastication, and encephalization. Annual Review of Anthropology 11: ANTH201 (

Advantages of Bipedalism
Travel for food Transport food Feed in stationary position Avoid predatory attacks Thermoregulatory advantages Tool use

Anatomy of Bipedalism Shorter/broader pelvis Valgus angle Knee
The angle the femur (leg bone) makes relative to the knee. About 90 degrees in apes, less in bipeds Anatomy of Bipedalism Shorter/broader pelvis Human Great Ape Valgus angle Knee Lengthened lower limbs Bipedalism is not a simple anatomical adaptation, but involves changes to most of the skeletal system. Humans have a shorter, broader pelvis than apes. The human femur (upper leg bone) forms an angles of less than 90° with the knee, whereas in the ape, the angle is nearly 90°. The human knee has the ability to be fully extended, whereas the ape knee cannot do so. The lower leg bones are longer in the human compared to apes. In addition, joint surfaces are enlarged in humans to compensate for the added stress of bipedal locomotion. Definitions Valgus angle The angle the femur (upper leg bone) makes relative to the knee. About 90 degrees in apes, less in bipeds. Enlarged joint surfaces

Anatomy of Bipedalism Restructuring of ear bones Platform foot
Human Great Ape Foot arches Relocation of hallux (big toe) Bipedalism requires adjustments to the inner ear, since bipedal animals must be able to balance on two legs. There are major changes in the feet, which include a reduction in the size of the toes, a non-opposable hallux (big toe), which is relocated in line with the other toes, and the formation of an foot arch (as opposed to flat feet). The redesigned foot forms a platform to be able to support the entire weight of the body.

Anatomy of Bipedalism Relocation of foramen magnum
Human Great Ape Lower/upper spine curvature Restructuring of rib cage Bipedalism requires significant changes to the thoracic skeletal system. The foramen magnum must be relocated from the back of the skull to the base of the skull since the skull must be perpendicular to the spinal column. The upper and lower spine of bipedal creatures must be curved to absorb the shock of the bipedal gate. In contrast, the spine of apes is nearly straight. In addition, the rib cage of bipeds is barrel shaped, in contrast to the inverted V-shape of the apes. The muscles that attach to these bones must be restructured to accommodate the skeletal changes. Definitions Foramen magnum The area where the spine joins the skull. Rearrangement of musculature

Ecology of Bipedalism A. ramidus (5.8 and 4.5 mya)
Early australopithecines lived in mixed woodland and savanna A. ramidus (5.8 and 4.5 mya) A. anamensis (4.2 mya) A. afarensis (3.9 mya) A. bahrelghazari (3.5 mya)

Natural History of Bipedalism
Facultative bipeds A. ramidus (5.8 mya) A. anamensis (4.2 mya) A. habilis (2.5 mya) Early facultative bipeds include A. ramidus (5.8 mya) A. anamensis (4.2 mya) and A. habilis (2.5 mya). Definitions Facultative biped A creature that has the ability to walk on two legs, but is not required to do so. Such creatures often walked as quadrapeds or spent extensive time in trees.

Obligatory bipeds (type I) H. erectus (2 million years ago) H. neandertalensis (150,000 years ago) Obligate bipeds include H. erectus (2 million years ago) and H. neandertalensis (150,000 years ago). Definitions Obligatory biped A creature that must walk on two legs. Such a creature is unable to walk as a quadraped efficiently.

Obligatory bipeds (type II) Homo sapiens sapiens (modern humans) (50,000 years ago) The final obligatory biped was Homo sapiens sapiens (50,000 years ago).

Bipedalism in Hominins
Large brain, small teeth, obligate biped Man (Homo sapiens) H. neandertalensis H. heidelbergensis H. erectus H. ergaster Hominins Superfamily including the hominids (Genus Homo and Australopithecus) along with the bipedal apes and chimpanzees. Small brain, very large teeth, facultative biped P. boisei P. robusts A. ramidus Small brain, large teeth, facultative biped A. habilis A. afarensis A. africanus A. anamensis Small brain, small teeth, quadruped Chimpanzee (Pan) Insufficient evidence H. antecessor H. rudolfemsis A. garbi K. platyops P. aethiopicus O. tugenesis S. tchadensis A. bahreighazali This is a summary of the data available for bipedalism in the superfamily hominins. Definitions Hominins Superfamily including the hominids (Genus Homo and Australopithecus) along with the bipedal apes and chimpanzees. 1 2 3 4 5 6 7 8 Time (MYA)

Emergence of Bipedalism
Minimal driving force/selective pressure Appears suddenly in the fossil record Requires major anatomical rearrangement Rapid change followed by period of no change In conclusion, bipedalism seems to have arisen at a time and place where there was little or no ecological or environmental pressure to have selected for its evolution. Bipedalism appeared suddenly in the fossil record over 5 million years ago. The adaptations necessary to achieve bipedalism are remarkably extensive, and many of the evolutionary models do not provide a mechanism by which intermediates would be selectively advantaged.

Origin of Man Creation Model
All Humans ADAM & EVE All other bipedal primate species are a special creation of God In conclusion, the creation model fits the available scientific data better than any of the evolutionary models for the origin of man.

Origin of the Human Races
Biblical and Scientific Explanations The next 18 slides examine the origin of the human races from a biblical and scientific perspective.

Origin of the Races God’s original command: And God blessed them; and God said to them, "Be fruitful and multiply, and fill the earth..." (Genesis 1:28) God's first command to humans was to "be fruitful and multiply, and fill the earth." Although humans did multiply, they failed to fill the earth as commanded.1 Instead, the original humans filled the earth with violence and murder. Things became so bad that God destroyed all but eight humans through the flood.2 References And God blessed them; and God said to them, "Be fruitful and multiply, and fill the earth, and subdue it; and rule over the fish of the sea and over the birds of the sky, and over every living thing that moves on the earth." (Genesis 1:28) See Genesis 6-9.

Origin of the Races God reissued his command: "and as for you, be fruitful and multiply; Populate the earth abundantly and multiply in it." (Genesis 9:7) After the flood, God declared the penalty for murder1 and reissued His command to fill the earth. References "Whoever sheds man's blood, By man his blood shall be shed, For in the image of God He made man." (Genesis 9:6)

World Peace and Unity? Human pride and greed result in oppression of people Media-Persia Greece Rome People often promote the idea of world peace and unity of all peoples. In principle, this would seem like a good idea. However, pride and greed for power usually leads to the oppression of people by those in power. The great empires of Media-Persia, Greece, and Rome stand out as primary examples of this principle. More modern examples include Germany, Japan, and the Soviet Union. God's command to fill the earth was given at least partially in response to man's propensity for oppressing his neighbors.

God’s Peace and Unity “Do you suppose that I came to grant peace on earth? I tell you, no, but rather division;” (Luke 12:51) “Peace I leave with you; My peace I give you. I do not give to you as the world gives.” (John 14:27) Jesus Christ, the "Prince of Peace" and greater preacher of peace, did not come to unite the world in peace and unity. The peace that Jesus Christ promised was peace with God.1 Because most of the world's population has always opposed God,2 accepting peace with God results in division and conflict with the world.3 References Therefore having been justified by faith, we have peace with God through our Lord Jesus Christ (Romans 5:1) Grace and peace be multiplied to you in the knowledge of God and of Jesus our Lord (2 Peter 1:2) You adulterous people, don't you know that friendship with the world is hatred toward God? Anyone who chooses to be a friend of the world becomes an enemy of God. (James 4:4) "Then they will deliver you to tribulation, and will kill you, and you will be hated by all nations on account of My name." (Matthew 24:9) "These things I have spoken to you, that in Me you may have peace. In the world you have tribulation, but take courage; I have overcome the world." (John 16:33)

Early Post-Flood Civilization
Biblical data Rapid repopulation of Mesopotamia Nimrod built 8 large cities, including Nineveh The Bible describes a rapid repopulation of Mesopotamia following the flood. One of the early rulers, Nimrod, built eight large cities, including Nineveh.1 All the cities described in early post-flood times were located in the area of Mesopotamia. References Now Cush became the father of Nimrod; he became a mighty one on the earth. He was a mighty hunter before the LORD; therefore it is said, "Like Nimrod a mighty hunter before the LORD." And the beginning of his kingdom was Babel and Erech and Accad and Calneh, in the land of Shinar. From that land he went forth into Assyria, and built Nineveh and Rehoboth-Ir and Calah, and Resen between Nineveh and Calah; that is the great city. (Genesis 10:8-12)

Scattering of the World’s People
Biblical data At the city of Babel, the people began building a huge tower God confused their language and scattered them over the face of the earth At one of the cities that Nimrod built, Babel, the people united together to build a huge tower "to heaven" in order to achieve a name for themselves in opposition to God.1 So God confused their language and scattered them over the whole earth2 to prevent the kind of wickedness that had taken place during the human unity prior to the flood.3 References And they said to one another, "Come, let us make bricks and burn them thoroughly." And they used brick for stone, and they used tar for mortar. And they said, "Come, let us build for ourselves a city, and a tower whose top will reach into heaven, and let us make for ourselves a name; lest we be scattered abroad over the face of the whole earth." (Genesis 11:3-4) So the LORD scattered them abroad from there over the face of the whole earth; and they stopped building the city. Therefore its name was called Babel, because there the LORD confused the language of the whole earth; and from there the LORD scattered them abroad over the face of the whole earth. (Genesis 11:8-9) Then the LORD saw that the wickedness of man was great on the earth, and that every intent of the thoughts of his heart was only evil continually. (Genesis 6:5)

Scattering of the World’s People
Geographic barriers Bering Strait – Americas and Asia Strait of Malaca – Indonesia and Asia Torres Strait – Australia and Asia Land bridges established by the ice age At one time, all the present continents were part of one super-continent, Pangea. However, well before man was created, this continent began to separate. By the time humans were created, the continents were quite similar to what we see today. The world's oceans have formed geographic barriers that have separated the continents. However, during the last ice age, sea levels dropped several hundred feet, temporarily connecting the major continents. It has been proposed that God scattered the human populations during the time that the continents were temporarily connected.

Dividing the Earth Biblical data
Two sons were born to Eber: One was named Peleg, because in his time the earth was divided… (Genesis 10:25) Scientific Data Land bridges covered by rising oceans ~11,000 ya It has been proposed that the dividing of the earth in the days of Peleg was caused by the covering of land bridges at the end of the last ice age. The scientific data indicates that the temporary land bridges between continents were covered completely by 11,000 years ago.1 Peleg is derived from the Hebrew word palag, which means “divide” or “divided”. This word occurs 4 times in the Old Testament. Twice it refers to the Sons of Eber (Genesis 10:25 and 1 Chronicles 1:19).2 A third time, it refers to making a channel from a flood (Job 38:25)3 and the fourth time it refers to the confusion of the speech of the wicked (Psalms 55:9).4 The use of the word Peleg in reference to creating a channel from a flood suggests that God might have used the melting ice from the last glaciation to remove the land bridges to separate the major human populations. Definitions Peleg To divide, split, or cleave. Brown-Driver-Briggs' Hebrew Definitions: palag (Strong's H6385) to divide, split (Niphal) to be split, be divided (Piel) to split, cleave to divide Part of Speech: verb A Related Word by BDB/Strong’s Number: a primitive root Same Word by TWOT Number: 1769 References S. A. Elias, et al Life and Times of the Bering Land Bridge. Nature 382: And two sons were born to Eber; the name of the one was Peleg, for in his days the earth was divided; and his brother's name was Joktan. (Genesis 10:25) And two sons were born to Eber, the name of the one was Peleg, for in his days the earth was divided, and his brother's name was Joktan. (1 Chronicles 1:19) "Who has cleft a channel for the flood, Or a way for the thunderbolt; (Job 38:25) Confuse, O Lord, divide their tongues, For I have seen violence and strife in the city. (Psalms 55:9)

Origin of the Races What the Bible says
Moses married a Cushite woman) (Numbers 12:1) Solomon married a black woman (Song of Songs 1:5) Ethiopians described as dark-skinned (Jeremiah 13:23) Contrary to the claims of some, the Bible makes no direct claims about the origin of the races. In fact, the Bible is remarkably silent on this issue. The first mention of race occurs many thousands of years after the flood, in the book of Numbers, describing the marriage of Moses to a Cushite woman (the Cushites were black).1 King Solomon also married a black women, which is described in his book, the Song of Songs.2 The book of Jeremiah describes the Ethiopians as dark-skinned peoples, but not how they got that way.3 Other than these few verses, the Old Testament is entirely silent about when and how the races originated. References Then Miriam and Aaron spoke against Moses because of the Cushite woman whom he had married (for he had married a Cushite woman); and they said, "Has the LORD indeed spoken only through Moses? Has He not spoken through us as well?" And the LORD heard it. (Now the man Moses was very humble, more than any man who was on the face of the earth.) (Numbers 12:1-3) "I am black but lovely, O daughters of Jerusalem, Like the tents of Kedar, Like the curtains of Solomon." (Song of Songs 1:5) "Can the Ethiopian change his skin Or the leopard his spots? Then you also can do good Who are accustomed to doing evil." (Jeremiah 13:23)

Origin of the Races What the Bible doesn’t say
When and how did the races begin? No biblical data – Not important enough to mention? Mark of Cain? Ham’s penalty? Part of the scattering at the Tower of Babel? Although there is no direct biblical data regarding the origin of the races, people have speculated that certain judgments of God caused the races to begin. According to the Book of Mormon (not part of the Bible), the unbelief of the Lamanites (the supposed ancestors of Native Americans) led God to put a curse of black skin on them, whereas the Nephites were still “white, and exceedingly fair and delightsome.”1 Others have speculated that the mark God put on Cain as a penalty for murdering his brother Abel was a change of skin color. However, the Bible does not give any hint about what the "mark" of Cain was.2 In addition, Cain is not in the line of descent to Noah, so any racial changes that might have been made would have disappeared at the flood. Some have speculated that Ham's penalty might have been a change of race. However, the text says only that Ham's descendants would be servants to his brothers.3 Another speculation is that God changed the races at the same time he scattered the people at the Tower of Babel. Although this is possible, the Genesis account is entirely silent about this kind of action on the part of God.4 Given the silence of the Bible on the subject of the origin of the races, one might conclude that the topic was thought to be unimportant in the overall scope of the Bible. References And he had caused the acursing to come upon them, yea, even a sore cursing, because of their iniquity. For behold, they had hardened their hearts against him, that they had become like unto a flint; wherefore, as they were white, and exceedingly fair and delightsome, that they might not be enticing unto my people the Lord God did cause a skin of blackness to come upon them. (2 Nephi 5:21) "And Cain said to the LORD, "My punishment is too great to bear! "Behold, Thou hast driven me this day from the face of the ground; and from Thy face I shall be hidden, and I shall be a vagrant and a wanderer on the earth, and it will come about that whoever finds me will kill me." So the LORD said to him, "Therefore whoever kills Cain, vengeance will be taken on him sevenfold." And the LORD appointed a sign for Cain, lest anyone finding him should slay him. (Genesis 4:13-15) "And Ham, the father of Canaan, saw the nakedness of his father, and told his two brothers outside.... When Noah awoke from his wine, he knew what his youngest son had done to him. So he said, "Cursed be Canaan; A servant of servants He shall be to his brothers." He also said, "Blessed be the LORD, The God of Shem; And let Canaan be his servant. "May God enlarge Japheth, And let him dwell in the tents of Shem; And let Canaan be his servant." (Genesis 9:22-27) Now the whole earth used the same language and the same words. And it came about as they journeyed east, that they found a plain in the land of Shinar and settled there. And they said to one another, "Come, let us make bricks and burn them thoroughly." And they used brick for stone, and they used tar for mortar. And they said, "Come, let us build for ourselves a city, and a tower whose top will reach into heaven, and let us make for ourselves a name; lest we be scattered abroad over the face of the whole earth." And the LORD came down to see the city and the tower which the sons of men had built. And the LORD said, "Behold, they are one people, and they all have the same language. And this is what they began to do, and now nothing which they purpose to do will be impossible for them. "Come, let Us go down and there confuse their language, that they may not understand one another's speech." So the LORD scattered them abroad from there over the face of the whole earth; and they stopped building the city. Therefore its name was called Babel, because there the LORD confused the language of the whole earth; and from there the LORD scattered them abroad over the face of the whole earth. These are the records of the generations of Shem. Shem was one hundred years old, and became the father of Arpachshad two years after the flood; (Genesis 11:1-10)

Origin of the Races Race facts:
Single biological species - Homo sapiens sapiens. Race described on the basis of skin color, hair form, facial morphology, body proportions, and other, less obvious traits – not based upon genetics There are many myths about race that are quite prevalent in most societies. The facts show that humans are all part of the same biological species and subspecies (Homo sapiens sapiens). Different human races are, on average, about four times more genetically similar than different populations of chimpanzees (which we would say "all look alike"). Races were originally defined on the basis of external phenotypic (appearance) characteristics. When originally defined, people did not know that the genetic changes that control skin color, facial morphology, etc. represent a very small percentage of the genes that control the human genome.

Origin of the Races Scientific classification
African (groups indigenous to Africa) Caucasian (European populations) Greater Asian (Mongols, Polynesians, Micronesians) Amerindian (North & South American Indians, Eskimos) Australoid (Australia, Papua) Scientifically, the human races are classified on the basis of geographic origin - African (groups indigenous to Africa), Caucasian (European populations), Greater Asian (Mongols, Polynesians, Micronesians), Amerindian (North & South American Indians, Eskimos), and Australoid (Australia, Papua).

Biological Basis for Race
No specific “race genes” Skin color – melanin (phenomelanin and eumelanin) Melanin expression – controlled by the enzyme tyrosinase All people have enough tyrosinase to be very black in skin color Regulation of the tyrosinase determines skin color To most people's surprise, there are no specific genes that define any particular race. In other words, all races share exactly the same genes. The races do exhibit polymorphisms (genetic variation at a specific locus), which tend to be more or less predominant in certain races, although nearly all can be found among all races in at least low levels. The major determinant of race, skin color, is controlled by genes that are present in all races. Melanin, which exists in two forms (phenomelanin and eumelanin) is expressed as yellow and black skin color, respectively. The darkness of skin color (expression of melanin) is dependent upon the enzyme tyrosinase, which all races have in enough abundance to have very black skin color. However, the regulation of tyrosinase determines what color the skin appears.

Origin of the Races Protein polymorphisms
84% of all variation is found within each racial group 10% of variation is found among racial groups More genetic variation within races than between them The genetics of racial differences are quite surprising to most people. When scientists examine protein polymorphisms (small genetic differences between people), the vast majority of differences (84%) are found within each racial group (between individuals of the same race). Only 10% of the variation is found between racial groups. Therefore, by far, there is more genetic variation within each race than between racial groups. In other words, the genetic differences that we cannot see visually are much more prevalent than the genetic differences we can see (racial differences).

Skin Color Distribution Vs. Blood Type
Relative Skin Color equator Type A Type B The pattern of skin color around the world shows that dark skinned people are more prevalent near the equator whereas light skinned people predominate toward the poles. However, other markers of diversity don't show such simple worldwide patterns. Blood types (A and B, shown above) show a much more complex distribution pattern, with most blood types being expressed nearly worldwide. These data show that racial characteristics are mostly "skin deep."

“Racial” Diversity Among Chimpanzees Compared to Humans
Measure Chimps Humans X-chromosome 0.13% 0.037% mtDNA (MPSD) 14.8 3.4 Fst values >2.0 0.08 Substitution rate >0.05 0.029 Heterozygosity 3.9% 1.8% We tend not to think that other species can be separated into races (other than maybe dogs and cats, which we have bred to look different). When we compare human genetic diversity to chimpanzees (which we would say "all look alike"), we find that chimpanzees are two to four times more genetically diverse than the global human population. Therefore, the scientific data shows that racial differences do not reflect massive genetic diversity. References Henrik Kaessmann, Victor Wiebe, Svante Pääbo Extensive Nuclear DNA Sequence Diversity Among Chimpanzees. Science 286: Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. Grossschmidt, G. Possnert, M. Paunovic, and S. Pääbo A view of Neandertal genetic diversity Nature Genetics 26: M. Nei and A. K. Roychoudhury Genetic relationship and evolution of human races. Evolutionary Biology 14: 1-59. Janczewski DN. Goldman D. O'Brien SJ Molecular genetic divergence of orangutan (Pongo pygmaeus) subspecies based on isozyme and two-dimensional gel electrophoresis. Journal of Heredity 81:

Scientific Theories on the Origin of Human Races
Dark skin protects against ultraviolet radiation and cancer Light skin allows enhanced formation of vitamin D3 Exception – Inuit (Eskimos) Selective breeding Several scientific theories have been proposed to explain the origins of the human races. The most prevalent theory to explain the origin of the races is that increased melanin protected people from ultraviolet radiation in the tropics. The problem with this theory is that the cancer that results from excessive UV exposure almost always occurs after the reproductive years. Therefore, the death of people after their genes have already been passed on could never be selected by evolution. Another theory states that peoples from Northern latitudes must have reduced pigment in their skin to form enough vitamin D3 under the reduced solar luminosity found at the higher latitudes. One problem with this theory is that the Inuits (Eskimos) have dark skin, but live in high latitudes. The most likely theory is that people have selectively chosen to breed with others who look like them. As the perception of beauty has changed, populations have slowly drifted towards the current racial patterns that we now observe.

Origin of Races – Conclusions
The origin of the races was not thought to be important enough to put in the Bible Biological changes required to produce human races are well within those possible through microevolutionary processes Neither the Bible nor science give us an absolute picture of how the human races arose. The Bible contains no explanation of when or how races came to be. Science tells us that the genetic differences among the races are very small. Such minor genetic differences can be easily explained through selective breeding using microevolutionary processes.

Modern Humans – Comparison of Models
Appearance Creation Darwinism Fossils Suddenly Gradual Culture Rapid Location Single site Many sites? Descent None Unknown ancestor Both the biblical creation model and evolutionary Darwinism make claims about the origin of modern humans. The biblical creation model says that mankind arose recently and suddenly from a single geographic location. The biblical model states that the appearance of modern humans coincided with the sudden appearance of human culture. In contrast, Darwinism predicts that humans arose gradually from ancient genetic roots, probably from multiple genetic sites. These predictions are not supported by the current scientific data, suggesting the the creation model is superior to Darwinism.

Summary Modern humans originated recently from a small population at a single geographic location Modern culture and religious expression appeared suddenly and dramatically Modern humans are not descended from Neandertal, H. erectus or any other identifiable bipedal hominid

Conclusions Naturalistic explanations fail to explain the origin of modern man Supernatural creation is a superior model for understanding man’s origin The races of man likely originated from selective breeding and not a supernatural act, although they may have been the indirect result of the scattering at the tower of Babel

Origin of Man and the Races

Similar presentations

Presentation on theme: "Origin of Man and the Races"— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

Origin of Man and the Races

Similar presentations

Presentation on theme: "Origin of Man and the Races"— Presentation transcript:

Similar presentations

About project

Feedback