1. PyroMark™ Q24 Andrea Tesoriero Application Specialist

2. Agenda Introduction Pyrosequencing technology Pyrosequecing workflow
PyroMark Q24
Instrument
System
Software
AQ workflow
Mutation example – KRAS
CpG Workflow

3. What is Pyrosequencing?
Sequencing by Synthesis:
Ronaghi M., Uhlén M., Nyrén P. (1998)
Real-Time Pyrophosphate Detection for DNA Sequencing.
Science 281:
Sequence based technology in real time
Simple and robust
No separation, gel, label or probes
In built controls
Flexible
in throughput
in assay design
in type of applications
quantitation
Pyrosequencing is a sequencing chemistry based on sequencing by synthesis. It doesn’t use dyes or labels or gels so doesn’t suffer from all the usual artifacts associated with sequencing chemistries. This makes it very accurate and very fast. Sequencing takes place in solution “in front of your eyes” ie in real time, you don’t run a reaction then a gel then analyse your results…it all happens simultaneously.

4. Pyrosequencing Assays
Amplification of Region of interest (PCR)
Pyrosequencing Analysis
Sequencing
primer
PCR primer
Region of
interest
Biotinylated
PCR primer 4

5. Pyrosequencing Workflow
PCR
Sample Preparation – 10 min
Pyrosequencing Analysis – min/plate

6. Pyrosequencing Workflow PCR and Sample preparation
1. PCR with one of the primers biotinylated
2. Immobilize biotinylated PCR products onto streptavidin coated beads
3. Separate strands by denaturation in NaOH
4. Wash /neutralize the immobilized strand
5. Anneal sequencing primer
1-2 h
10-15 min
Run Pyrosequencing min

7. Pyrosequencing Workflow Sample Preparation
Vacuum tool
Water
Washing buffer
Denaturation Solution
(NaOH)
EtOH
PSQ plate with sequencing primer
PCR product immobilized on Sepharose beads

8. Pyrosequencing Workflow Sample preparation
1-24 post-PCR samples prepared in parallel in less than 15 minutes
Minimal pipetting
Actual hands-on time, less than 1 minute
Plastic waste reduced to a minimum 8

9. Pyrosequencing Workflow
Enzyme Cascade
Time
Light
PPi
ATP

10. Pyrosequencing Workflow A Pyrogram™ is generated

11. Pyrosequencing Workflow A Pyrogram™ is generated
Variable
Region GG
TTT G C
Reference Sequence

12. Pyrosequencing Workflow A Pyrogram™ is generated
Sequence to Analyse = a/gCTGCCT
Genotype = A/G Heterozygote
Double height ref peak
Single height ref peaks
2 half height peaks C A G T C T G C T
Negative controls
Reference Peaks

13. Pyrosequencing Workflow Unequivocal genotype classification
ACTGCCT
TGACGGA---
Homozygous A
ACTGCCT
TGACGGA--- A G C T
GCTGCCT
CGACGGA---
Homozygous G
GCTGCCT
CGACGGA--- A G C T A G
ACTGCCT
TGACGGA---
Heterozygous A/G
GCTGCCT
CGACGGA--- A G C T

14. PyroMarkTM Q24 A Small Smart Affordable Pyrosequencing
System with a 24 well plate format
A complete solution for Mutation and Methylation Analysis
CpG methylation
Allele quantification
Mutation analysis 14

15. PyroMark™ Q24 Instrument Design
X-Y drive
Positioning A C G T
Reagent cartridge
Ink jet delivery
24 well plate
Mixer and thermostat
Instrument design
This is a technical drawing of the interior instrument design and shows the position of reagent cartridge, plate and CCD camera
Key things to describe:
An X-Y drive moves the reagent cartridge over the plate
Dispensation of reagents by ink jet delivery in all wells
The 96 well plate is placed in a thermostatted heating block housed on top of a shaker table for efficient mixing of reagents and beads in the wells
Detection of the light in all wells allows for simultaneous monitoring of the sequencing events in all wells, thus real time sequencing.
24 individual CCD Chips
Detection

16. PyroMarkTM Q24 System Reagents Application and Assay Design software
Instrument
Vacuum Prep. Workstation

17. PyroMark™ Q24 Benefits
An extremely easy to use system - Up to 24 samples in parallel
Small Footprint
Takes very little bench space
Measuring only H420xW390xD525mm
Robust
Can be run at ambient temperatures between 15°C and 32°C.
Runs can be set up and analyzed on any PC anywhere, running PyroMark™Q24 Software.
Information is transferred between the instrument and computer via a USB memory stick.
Conforms to EU IVDD so suitable for clinical use in Europe

18. PyroMark™ Q24 Software
The software has two analysis modes:
AQ - A variety of quantification studies and SNP analysis.
CpG - Methylation analysis of multiple consecutive CpG sites.
AQ assays and CpG assays can be performed on the same PyroMark™ Q24 Plate.
5 multi licenses
You can toggle between the analysis modes in the analysis view of the software, by selecting AQ or CpG in the toolbar.
Both modes offer detailed report information that can be exported to html, Excel, text and PDF formats. 18

19. PyroMark™ Q24 software AQ mode
Frequency calculations of variable positions in sequence context including;
Single variable position AG/TC
Multiple variable positions AG/TCAG/TCAG/T/AC
Di- Tri- or Tetra-allelic mutations GA/C/G/TA
High resolution of individual sites
Quality assessment of individual sites and sequence context
SNP analysis (Multiple positions, Di- Tri- or Tetra-allelic variants)
Analysis of SNPs in the presence of CpG sites

20. Mutation example KRAS
Mutations in the KRAS gene results in a constitutively active KRAS protein which leads to abnormal cell growth, proliferation and differentiation.
KRAS is frequently mutated in
Colorectal cancer
Lung cancer
The most common KRAS mutations are found in codons 12,13 and 61
In several types of cancer the K-Ras gene is mutated, resulting in a loss of activity regulation and subsequently increased invasion and metastasis, and decreased apoptosis.
The highest frequency of mutated KRAS is found in pancreatic cancers (90%), but in colorectal and lung cancers up to 30% of the patients have mutations in KRAS. Characteristic for these cancers are that they are adeoncarcinoma (originate form adenovirus infections).
The most common mutations in KRAS are found at residue G12 and G13 in the P-loop and the catalytic residue Q61.

21. Mutation example KRAS – mutation frequency
Codon 12+13
Codon 61
= Guanine
7477 70 G
= Thymine T
= Cytosine C
= Adenine A
Basepair substitution
Basepair substitution
Flexible assay design facilitates analysis of contiguous, multivariable mutations
Wt seq G G T G G C C A A
Codon 61 FP
FPB
Seq
RPB RP
GGT GGC GTAGG
TCCA GTT CTC
Codon 12 & 13
PyroMark Q96/Q24 KRAS v2.0 test is an assay for mutation analysis of KRAS; optimized for use on any Pyrosequencing instrument.
The most frequent SNPs in KRAS codons 12, 13 and 61, resulting in amino acids exchange, is illustrated in the histogram. However, other rare mutations resulting in a aminoacid exhange is also reported, but the relevance of these are not known.
PyroMark Q96/ Q24 KRAS v2.0 test assay is designed to amplify the two DNA regions in the KRAS gene where the most frequent mutations are found. The PCR results in a ≈120bp amplicon which is more than half the size compared to the previous assay. In paraffin embedded tissues the DNA is often degraded in pieces about 200 bp. The new primers improve the PCR and ensure high quality sequence data.
The codons analysis is designed as an forward assay while the assay for codon 61 is designed in reverse order.
Assays performed according to the ”Instructions for use” enables detection of nucleotide substitutions in position and 2 of codons 12 and 13 and position 3 in codon 61. In addition, post-run analysis of peaks in an Excel macro enables identification of rare mutations in the codons. Quantification of these mutations can be performed on MD and ID instruments by running a new sample with changed ”Sequence to Analyze”. PyroMark Q24 application software contains a function that post run enables quantification of rare mutations by just changing the sequence to analyze in the run-file.

22. Mutation example The KRAS 2.0 assay
Codons 12 13 61
Wt seq G C T C A A C T A
Multi-variable mutations C T G C G C T G A C T
BND FP
Seq
RPB
NNt RVc
Codon 12 & 13
Codon 61
FPB RP

23. Mutation example The KRAS 2.0 assay
Efficient detection and quantification of mutations in codons 12, 13 and 61 with built in quality control
1 well/sample for all Codon 12 & 13 mutations (9 reported mutations)
1 well/sample for all Codon 61 mutations (7 reported mutations)
Provides high quality data of DNA from fresh, frozen and paraffin-embedded tumor samples
Sequence context provides built-in control and eliminates false positives/negatives

24. Mutation example The KRAS assay – Wild Type

25. Mutation example The KRAS assay – codon 12 position 2
GGT>GCT
Gly12Ala
GGT>GAT
Gly12Asp
GGT>GTT
Gly12Val

26. Mutation example The KRAS assay – codon 12 position 1
GGT>TGT
Gly12Cys
GGT>AGT
Gly12Ser

27. Mutation example The KRAS assay – codons 13 and 61
GGC>GAC
Gly13Asp
CAA>CAC
Gln61His
TTG>GTG

28. Mutation example The KRAS assay – Conclusions
1 PCR to cover ALL mutations in codons 12 & 13
Minimises amount of gDNA needed (10ng)
Optional second PCR to cover all mutations in codon 61
Provides results for rarer but important mutations not covered by other methods
Fast results
PCR product to quantitative result in ~ 30 minutes for 24 samples

29. CpG methylation analysismC C
1. Bisulfite conversion
2. PCR amplification
3. Pyrosequencing C U C C U T
25%
75%
Degree of methylation is automatically analyzed by the software. mC C

30. CpG methylation analysis Assay design
CpG island
Sequencing primer
PCR primer
CpG sites
PCR primer
All primers are located in non-variable regions, in between CpG sites
Enables analysis of several adjacent CpG sites with one sequencing primer
Freedom in positioning of the sequencing primer
distance from CpG site
orientation of assay
The primer placement for Pyrosequencing analysis is flexible, unlike competitors like MSP, SnapMeth, COBRA

31. CpG methylation analysis A range of analysis possibilities
Any single CpG site
Multiple consecutive CpG sites
One gene at a time
Several genes in the same analysis (analyze up to 24 different assays in one run)

32. Benefits of Pyrosequencing for CpG methylation analysis
Quantitative analysis of multiple consecutive sites
Flexible assay design
Forward – reverse/ Upper – lower
Flexible primer positioning
Built-in Bisulfite treatment control
Excellent Performance
Accuracy
Precision
Reproducibility over time
Confidently discern even small changes in methylation
Fast results

33. Benefits of Pyrosequencing for CpG methylation analysis Built-in quality control of bisulfite treatment
RASSF1A gene
Before bisulfite treatment
(RASSF1A)
No separate reaction needs to be run to ensure complete bisulfite conversion. Every single well will contain a built-in control.
CCGACATGGCCCGGTTGGGCCCGTGCTTCGCTGGCTTTGGGCGCTAGCAAGCGCGGGCCGGGCGGGGC
Analyzed sequence
TYGATATGGTTYGGTTGGGTTYGTGTTTYGTTGGTTTTGGGYGTTAGTAAGYGYGGGTYGGGYGGGGT
Any C not followed by a G gives bisulfite QC

34. Benefits of Pyrosequencing for CpG methylation analysis Accuracy - Linear response in measured methylation
Normal DNA
Colon cancer DNA
This is illustrating how accurate the analysis is – a perfectly linear relationship was observed in this experiment.
Linear response of methylation measured by Pyrosequencing in PCR-amplified products generated from controlled dilutions of in-vitro methylated (IVM) genomic DNA with unmethylated DNA (IVM DNA is 80% methylated).
Sequence to analyze:
GGGTGGGGYGGATYGYGTGYGT

35. Methylation levels are consistent even when using different primers
Benefits of Pyrosequencing for CpG methylation analysis Accuracy – using different sequencing primers
Methylation levels are consistent even when using different primers
Seq. Primer 3
Seq. Primer 2
Seq. Primer 1
MLH1 gene
A region of 73 bases, containing 12 CpG sites, was analyzed using 3 different sequencing primers. All values above are based on the average of 3 replicates. Note how well the methylation values correlate, regardless of primer.
73 bases
Each methylation value is the mean of 3 replicates

36. Benefits of Pyrosequencing for CpG methylation analysis Consistent precision among CpG sites
Confidently measure the individual degree of methylation in adjacent CpG sites, even at long distances from the sequencing primer
Pos Pos Pos Pos. 4 Pos Pos Pos Pos Pos Pos. 10
MGMT gene
Does the distance from the sequencing primer affect the precision of methylation results?
The standard deviation of the 10th site is just as low as that of the first site from the sequencing primer.
(Based on replicate Pyrosequencing, not replicate PCR.)

37. Benefits of Pyrosequencing for CpG methylation analysis Quantification of individual CpG sites
Methylation levels may vary from site to site
Pyrosequencing detects site variation reproducibly
This experiment shows
The reproducibility of methylation analysis using Pyrosequencing
The importance of analyzing several, consecutive CPG sites. Using other methods, that just look at one single CpG position, one might get a non-representative value (site number 2 in this experiment serves as a good example). The relevance of these variations are yet unknown. Shaw et al (2006) discusses this phenomena, and it might be due to steric hindrance of the methylating enzymes. Nevertheless, this shows the importance of analyzing multiple, consecutive sites.
(Values based on repeated Pyrosequencing and repeated PCR.)
Methylation pattern in RASSF1A in neighboring CpG sites in 4 tumor samples (duplicate runs)

38. Imprinting Gene expression dependent on the parent of origin
Prader-Willi Syndrome (PWS) Angelman Syndrome (AS)
Neuro developmental disorders caused by a deficiency with 15q parental contributions
methylated on the maternal chromosome
remains unmethylated on paternal chromosome
PWS: lack of paternal contribution
paternal deletion (70%)
maternal uniparental disomy (25%)
AS: lack of a maternal contribution
maternal deletion (70%)
paternal uniparental disomy (5%)
In particular they looked at two pediatric disease in neuro development, Prada Will Syndrome and Angelman syndrome.
In PWS, there is a lack of paternal contribution and this can occur in two ways-paternal deletion or receiving two copies of the maternal allele (known as uniparental disomy).
AS is the exact opposite-lack of maternal contribution
(UPD-receive two copies of a chromosome from one parent) 38

39. Benefits of Pyrosequencing for CpG methylation analysis Flexible assay design
Analysis in either direction – Prader Willi/Angelman
Forward assay: C/T
Note how well the results achieved forward/reverse correlate to each other. The first site from left (upper pyrogram) corresponds to the first site from right (lower pyrogram).
Reverse assay: G/A

40. Software Overview

41. PyroMark™ product line Cancer mutations, methylation, clinical genetics
Genetic tests that show real sequence information.
PyroMark RUO
Optimized PCR and Pyrosequencing protocols, built-in quality control
Cancer Mutations: KRAS, BRAF
CpG Methylation: p16, MLH1, LINE-1, MGMT
Clinical Genetics: APOE, HFE, MTHFR, Prader-Willi/Angelman
PyroMark Assay Database
over 1,000 optimized & wet-tested assay designs
Continuous updates
Online access: 41

42. PyroMark product line Reagents Assay Kits Software Instruments
Product Offering Overview
Reagents
Assay Kits
Software
PyroMark Q96 MD
Instruments
PyroMark Q96 ID
PyroMark Q24 Workstation
Sample preparation
PyroMark Q24

43. Genetic Variation
SNP & mutation analysis
Simplex & multiplex SNP genotyping
Tri/tetra-allelic mutations
Quantification
CpG methylation analysis Analysis of polyploid genomes Allele-specific gene expression SNP pooling studies Viral/bacterial load Loss of heterozygosity Gene copy number
Short DNA sequencing
Microbial identification
Species discrimination
Sub-typing
Resistance detection
Sequence signatures DNA bar-coding Sequence variation Sequence verification Forensics Clone checking

44. Gracias por su atención